Patent Docs

Re-examination Ordered on "Expired" Harvard Oncomouse Patent

    By Kevin E. Noonan --

On Monday, the U.S. Patent and Trademark Office granted an ex parte reexamination request for U.S. Patent No. 5,925,803, the latest-filed and last-granted member of the Harvard Oncomouse patent family.  Remarkable about the petition is that the third party requester (TPR), Ellen Gonzales of Gonzales Patent Services, contends that the '803 patent has expired by operation of a terminal disclaimer filed in an earlier-filed application, but maintains that despite the putative expiration, the Office retains jurisdiction to consider the re-examination request.

There are three claims in the '803 patent, all directed to methods for testing a compound suspected to be a carcinogen:

1.  A method of testing a material suspected of being a carcinogen, comprising exposing a transgenic mouse to said material and detecting neoplasms as an indication of carcinogenicity, wherein the germ cells and somatic cells of said mouse contain an activated oncogene sequence introduced into said mouse, or an ancestor of said mouse, at an embryonic stage.

2.  A method of testing a material suspected of conferring protection against the development of neoplasms, said method comprising
    (1) providing a first and a second transgenic mouse, the germ cells and somatic cells of which contain an activated oncogene sequence introduced into said mice, or an ancestor of said mice, at an embryonic stage,
    (2) treating said first mouse with said material, and
    (3) detecting, as an indication of said protection, a reduced incidence of development of neoplasms in said first mouse, compared to the incidence in said second mouse, which is not so treated.

3.  The method of claim 1, further comprising exposing said first and second mice to a carcinogen prior to, after, or simultaneously with treating said first mouse with said material.

The TPR asserted six substantial new questions (SNQ) of patentability against these claims:

• SNQ1:  Claim 1 of the '803 Subject Patent is obvious in view of Claims 1, 11, and 12 of [grandparent U.S. Patent No. 4,736,866] in view of Ward et al. or Schach et al. under the doctrine of judicially-created obviousness-type double patenting.

• SNQ2:  Claims 1-3 of the '803 Subject Patent are unpatentable in view of the Claims 1-12 of the '866 Grandparent Patent under the doctrine of judicially-created obviousness-type double patenting.

• SNQ3:  Claims 2-3 of the '803 Subject Patent are obvious in view of the claims of the '866 Grandparent Patent in view of the Proctor Patent, under the doctrine of judicially-created obviousness-type double patenting.

• SNQ4:  Claims 1-3 of the '803 Subject Patent are obvious under 35 U.S.C. 103(a) in view of Schwab et al.

• SNQ5:  Claims 2-3 of the '803 Subject Patent are obvious under 35 U.S.C. 103(a) over Jaenisch et al. in view of the Proctor patent.

• SNQ6:  Claim 1 of the '803 Subject Patent is obvious under 35 U.S.C. 103(a) over Jaenisch et al. in view of the either Ward et al. or Schach et al.

TPR contends that the following describes the priority chain and the relationship between the grandparent '866 patent, parent U.S. Patent No. 5,087,571, and the '803 patent.  The '866 patent, according to the TPR, contained claims 1-12 directed to the Harvard oncomouse; claims 13-19 directed to methods for testing a compound suspected of being a carcinogen; and claims 20-22 directed to plasmid constructs; claim 1 is representative:

1.  A transgenic non-human mammal all of whose germ cells and somatic cells contain a recombinant activated oncogene sequence introduced into said mammal, or an ancestor of said mammal, at an embryonic stage.

The TPR contends in her request that the applicant cancelled the claims to the testing methods and let claims to the Harvard Oncomouse proceed to grant as the '866 patent.

The application that gave rise to the parent '571 patent, the TPR contends, was improperly designated as a "divisional application," despite the fact that no restriction requirement was raised against any of the claims of the '866 patent and that the patentee voluntarily cancelled the testing method claims in the '866 patent as part of their patenting strategy.  This application was filed initially with original claims 13-24 that had been cancelled during prosecution of the '866 patent.  Prosecution of the '571 patent resulted in two granted claims:

1.  A method of providing a cell culture comprising
    (1) providing a transgenic non-human mammal, all of whose germ cells and somatic cells contain a recombinant activated oncogene sequence introduced into said mammal, or an ancestor of said mammal, at an embryonic stage; and
    (2) culturing one or more of said somatic cells.

2.  A cell derived from a somatic cell obtained from a transgenic non-human mammal, all of whose germ cells and somatic cells contain a recombinant activated oncogene sequence introduced into said mammal, or an ancestor of said mammal, at an embryonic stage which cell contains said recombinant activated oncogene sequence.

Significantly, applicants filed a terminal disclaimer over the claims of the '866 patent in order to overcome an obviousness-type double patenting rejection raised against these claims.  The following language in the terminal disclaimer is important for the arguments successfully raised in the request (with emphasis added):

Your petitioner, President and Fellows of Harvard College, hereby disclaims any portion of an patent granted on the above-identified application or on any application which is entitled to the benefit of the filing date of this application under 35 U.S.C. 120 not extending the term of any patent granted on that application beyond the term of issued U.S. Patent No. 4,736,866 issued April 12, 1988.

The TPR contended that this language was not required in a terminal disclaimer and the patentees were bound by it (i.e., that it cannot be rescinded by certificate of correction, reissue, or reexamination, even if it was filed in error).  As in the '866 patent, patentees cancelled the testing method claims in the application that granted as the '571 patent.

The application that granted as the '803 patent was the first member of the priority chain having a restriction requirement, which was filed with claims 1-13 and 15-24 of the grandparent application.  This restriction requirement identified three groups:  claims 1-12 and 15-17, directed to a transgenic animal and methods for producing such an animal; claims 13, 18 and 19, drawn to suspected carcinogen testing methods; and claims 20-24 being drawn to plasmids; applicants elected to prosecute the testing method claims.  During prosecution the applicants overcame an obviousness rejection based on the '866 patent and the Ward and Schah references on the grounds that 35 U.S.C. § 121 "prohibits the USPTO from rejecting a later divisional application 'where (as here) the divisional application is filed as the result of a restriction requirement in the original case.'"  The TPR contended that this statement is inaccurate, insofar as there was no restriction requirement issued during prosecution of either the grandparent '866 patent or the '571 patent.

The TPR argued in the request that the '803 patent expired by operation of the terminal disclaimer filed in the '571 patent on July 12, 2005, the expiration date of the '866 patent.  Reexamination is still proper, she contended, because a reexamination "may be declared for an expired patent at any time during the enforceability of the patent" (emphasis in original), which will run until July 12, 2011 (i.e., six years after the patents expiration date; M.P.E.P. § 2211).  Moreover, a question arising as a result of obviousness-type double patenting is appropriate for raising a substantial new question of patentability in a reexamination (M.P.E.P. § 2217).  Finally, the TPR argued that public policy concerns supported the Office granting her request for reexamination:

TPR respectfully requests that a Reexamination nonetheless be declared to serve the public notice function of Reexaminations (i.e., to make it clear on the record that the '803 Subject Patent is only avoiding the double-patenting rejections because of the terminal disclaimer in the '571 Parent Patent, which likewise informs the public that the patent expired on July 12, 2005).  In such a case, even if a Reexamination is not declared, to serve the public notice function, TPR respectfully requests that the Patent Office indicate in writing that the terminal disclaimer in the '571 Parent Patent application insulates the '803 Subject Patent from obviousness type double patenting rejections, and further, affirmatively state that the '803 Subject Patent therefore expired on July 12, 2005.  This public notice function is particularly important in this case as the Patentee is publicly advertising that the '803 Subject Patent does not expire until July of 2016, which is 11 years past the actual expiration date.

The Office agreed.  As set forth under Reexamination Control No. 90/010,955, the Office granted the reexamination based on all six substantial new questions of patentability.  Although the paper granting the request cited revisions to the reexamination statute (35 U.S.C. § 301 et seq.) enacted by Congress in 2002 in response to the Federal Circuit's decision in the In re Portola Packaging case, which permit a reexamination request to be granted on art considered by the Office during ex parte prosecution provided that a substantial new question of patentability is raised, the paper also notes that all of the art cited by the TPR (except for the Ward reference) had not been considered by the examiner during prosecution of the '803 patent.  Moreover, the Office did not separately address the standing issue raised by the TPR, apparently agreeing that a reexamination is properly granted on an expired patent during the period where the patent right can be enforced.

The reexamination will be considered by Primary Examiners Brenda Brumback, Padmashri Ponnaluri, and SPE Deborah Jones.

Biotech/Pharma Issuances on the Rise

    By Donald Zuhn --

Last week, a post on Patently-O presented some interesting results regarding the percent of utility applications that had issued as patents as compared to the total number of issued patents and abandoned applications for eight technology centers (see "USPTO Grant Rate by Technology Center").  The post indicated that the results had been obtained from an analysis of about 25,000 utility applications filed over the past few years.  According to the post, TC 1600 (biotechnology and organic chemistry) had produced the lowest percent of issuances (less than 45%).

For a presentation at last month's BIO International Convention on the impact of the recession on biotech patent prosecution, we looked at the number of biotech/pharma patents that had issued between 2000 and 2010 and the number of biotech/pharma applications that had published over this same time frame.  The results of this analysis are shown in the graph below (note: figures for 2010 are projected based on issuances and publications through June 1):

In the graph above, the blue bars represent the number of patents designated as belonging to classes 424, 435, 436, 504, 506, and/or 514 that issued in the specified year.  The red line represents the number of patent applications designated as belonging to one of the above classes that published in the specified year (because the AIPA mandated publication of certain U.S. applications filed after November 28, 2000, no biotech/pharma applications were published in 2000 and only 3,920 biotech/pharma applications were published in 2001).

If the numbers through May hold up during the remainder of the year, biotech/pharma patent issuances could return to levels not seen since 2003, indicating that the Patent Office may indeed be putting the days (years?) of "reject, reject, reject" behind them.

Biotech/Pharma Docket

    By James DeGiulio --

AstraZeneca Settles Entocort Patent Suit with Teva, Stipulates with Mylan

AstraZeneca has settled its infringement claims against Teva over its Crohn's disease treatment Entocort, striking a deal that grants Teva an exclusive license to market a generic oral budesonide capsule on Feb. 15, 2012.  The companies will seek approval for the deal through a consent judgment in the U.S. District Court for the District of Delaware.

AstraZeneca brought suit against Barr in May 2008 following Barr's January ANDA filing, claiming Barr's generic budesonide infringed U.S. Patent Nos. 6,423,340 and 5,643,602.  AstraZeneca later brought a similar suit against Mylan, alleging infringement of the same Entocort patents (see "Court Report," July 27, 2008).  The Barr and Mylan suits, though initially separate, were consolidated in early 2009.

On May 19, AstraZeneca and Mylan stipulated to a judgment against Mylan, agreeing that both Entocort patents are valid and that Mylan infringed the '340 patent.  The only remaining issue in that case is whether the '340 patent is enforceable.

AstraZeneca's settlement terms with Teva were not available.  The stipulation in the Mylan case can be found here.

Sanofi-Aventis' Uroxatral Patent Valid, Mylan's Generic Infringes

On May 14, Mylan's generic alfuzosin drug was confirmed as infringing Sanofi's patent covering the prostate treatment Uroxatral after Mylan's contention that the patent was invalid for obviousness was rejected.  Sanofi brought an infringement suit against Mylan in 2007 following Mylan's ANDA filing, alleging Mylan's generic alfuzosin hydrochloride infringes U.S. Patent No. 4,661,491 (see "Court Report," October 14, 2007)  Mylan asserted that the '491 patent was obvious in view of three pieces of prior art.

In his May 14 order, Judge Sleet of the U.S. District Court for the District of Delaware held that the three prior art references asserted by Mylan fail to invalidate the '491 patent because they do not suggest that alfuzosin would prove an effective treatment for frequent urination and other symptoms of benign prostatic hyperplasia.  Judge Sleet then finalized an earlier bench ruling that Mylan's generic alfuzosin hydrochloride would infringe Sanofi's '491 patent.  However, Judge Sleet refused to award attorneys' fees to Sanofi, finding no bad faith or vexatious litigation on the part of Mylan.

Judge Sleet's order can be found here.

Mylan's Antitrust Claims Dismissed In AstraZeneca Prilosec Suit

In the latest development in AstraZeneca's long-running Prilosec infringement suit, AstraZeneca's motion to dismiss Mylan's antitrust counterclaims was granted and Mylan's motion for attorney's fees was denied.

AstraZeneca first sued several generic-drug makers in 2000, accusing them of infringing patents 4,786,505 and 4,853,230, covering the gastric-acid inhibitor Prilosec.  Mylan joined the litigation after releasing a generic version of omeprazole in August 2003.  At the May 2006 trial, Judge Barbara Jones of the U.S. District Court for the Southern District of New York found that AstraZeneca's two patents were valid, but defendants Mylan, LDE, and Lek did not infringe.  Other defendants Apotex and Impax were found liable for infringement.  The U.S. Court of Appeals for the Federal Circuit upheld the finding of noninfringement with respect to Mylan in June 2008 (as reported by Patent Docs on June 11, 2008).

On May 18, Judge Jones granted AstraZeneca's motion to dismiss with prejudice Mylan's counterclaims that AstraZeneca forced generic manufacturers out of the omeprazole market by launching sham patent litigation to delay the release of generic versions of the drug.  Judge Jones agreed with AstraZeneca's contention that its patent infringement litigation cannot give rise to antitrust liability under the Sherman Act because its claims were supported by probable cause.

Mylan also moved for attorneys' fees on the grounds that AstraZenca's infringement suit was meritless.  Judge Jones denied Mylan's motion for attorney's fees, finding that the case is not exceptional.

Judge Jones' May 18 order can be found here.

James DeGiulio has a doctorate in molecular biology and genetics from Northwestern University and is a third-year law student at the Northwestern University School of Law.  Dr. DeGiulio was a member of MBHB's 2009 class of summer associates, and he can be contacted at degiulio@mbhb.com.

IPO Releases List of Top 300 Patent Holders for 2009

"Biotech/Pharma" Top 47"

    By Donald Zuhn --

The Intellectual Property Owners Association (IPO) released its 27th annual list of the top 300 organizations receiving U.S. patents.  Patent Docs Readers may recall that the U.S. Patent & Trademark Office stopped releasing its annual list of top patent recipients in 2006 in order to "discourag[e] any perception that we believe more is better."

The IPO stated that while it does not intend for the report to "encourage or discourage patenting," it would continue to publish its annual list of top recipients because "the number of patents granted is one of the few objective measures of the patent system as a whole and the patenting activities of individual industries and companies."  The IPO compiled its list by counting the number of utility patents granted during 2009 on which an organization or its subsidiary was listed as the owner on the face of the patent.  However, the IPO attributed patents that were granted to two or more organizations jointly to the organization listed first on the patent.  The IPO noted that 165,213 patents were issued in 2009, which was an increase from the 154,699 patents that issued in 2008.  The top fifteen companies on the IPO Top 300 are listed below

As in past years, we used the IPO's list of top patent holders to compile a list of the top "biotech and pharma" companies and organizations receiving U.S. patents in 2009.  This year's list of 47 biotech and pharma companies and organizations reverses a downward trend that saw the number of biotech and pharma companies and organizations go from 51 in 2006 to 47 in 2007 to 43 last year.  Each organization's IPO top 300 ranking for 2009 is indicated in the "'09 IPO Rank" column; the IPO top 300 ranking for 2008 (if available) is indicated in the "'08 IPO Rank" column.  Please note that some of the companies and organizations listed below may be involved in non-biotech or non-pharma work, and therefore, a portion of the patents granted to these companies and organizations may be directed to other than biotech and pharma-related inventions.  In addition, our list is a little inclusive in that we included medical device companies.

 

For additional information regarding this topic, please see:

• "IPO Releases List of Top 300 Patent Holders for 2008," May 14, 2009
• "IPO Releases List of Top 300 Patent Holders," May 22, 2008
• "IPO Posts List of Top 300 Patent Holders," April 20, 2007

Reader Survey: How Has the Recession Impacted Your Patent Practice?

    By Donald Zuhn --

Earlier this year, we released our annual list of top biotech/pharma stories (see "Top Stories of 2009: #4 to #1").  At the top of our list, we placed the biotech/pharma industry's attempts to recover from the Great Recession.  Back in February of 2009, we noted that almost a third of the Biotechnology Industry Organization's membership had less than six months of cash on hand, 45% had less than one year of cash remaining, and only 10% of the 370 publicly-traded biotechnology companies reported a positive income.  Last April, the National Venture Capital Association (NVCA) and PricewaterhouseCoopers announced that venture capitalists had invested $3.0 billion in 549 deals in the first quarter of 2009, a 47% decrease in terms of dollars invested and a 37% decrease in terms of the number of deals as compared with the fourth quarter of 2008 -- levels of venture funding that had not been seen since 1997.

As 2009 wore on, some of the negative indicators appeared to be giving way to more positive signs.  Last August, Nashville-based Cumberland Pharmaceuticals snapped a two-year industry dry spell when it conducted an initial public offering (IPO) that raised $85 million, and in October, Talecris Biotherapeutics and Omeros Corp. conducted their own IPOs, raising $950 million and $68.2 million, respectively.  Other biotech/pharma companies have filed for IPOs since then (although a few recent biotech/pharma IPOs have produced somewhat disappointing results).  With respect to venture funding, VentureDeal's latest quarterly VC funding report indicated that biotech funding increased a "whopping" 65% during the fourth quarter of 2009 (see "VentureDeal Report Shows 65% Increase in Fourth Quarter Biotech Venture Funding"), and while the NVCA's report for the same period was less promising, the NVCA noted that the life sciences sector received the highest level of funding when compared with the other sixteen sectors the organization tracks.

However, while IPOs and venture funding levels speak to the impact of the recession on the biotech/pharma industry as a whole, these indicators provide little information regarding the impact of the recession on biotech/pharma patent practice in particular.  In order to get a better handle on the impact of the recession on biotech/pharma patent practice, we have begun to analyze data available at the U.S. Patent and Trademark Office website and other sources.  While this analysis progresses, we thought it might be a good idea to solicit comments from Patent Docs readers who have responded in the past to our call for an identification of "bad" patents (see "A Simple Question about Patent Quality") and ways to address the problems facing the USPTO after Tafas/GSK (see "Post-GSK: Where Do We Go from Here?").

So, our question to readers is this:  How has the recession impacted your patent practice?  In particular, has it changed the way you prosecute applications or litigate cases, and if so, how?  We would appreciate any and all comments you may have on the topic.  You may feel free to provide such comments in response to this post, e-mail them to the Patent Docs Gmail address (PatentDocs@gmail.com), or e-mail them directly to me (zuhn@mbhb.com).  If you would prefer that we withhold your name from any future posts on this subject, just let us know.  Over the next few weeks, we will collect your comments, perhaps post a few short surveys, and then report back with the results.  We thank you in advance for the help.

AUTM Survey Shows Drop in Issued Patents

    By Donald Zuhn --

Last month, the Association of University Technology Managers (AUTM) released its U.S. licensing survey for FY2008.  According to a GenomeWeb Daily News report, a majority of the academic and research institutions that answered the survey indicated that they filed more patent applications and were involved in more start-ups during the fiscal year ending June 30, 2008.  However, survey respondents also indicated that they secured fewer patents, entered into fewer licensing agreements, and saw the introduction of fewer new products during the survey period.

With respect to application filings, the survey showed that respondents disclosed 20,115 inventions in FY2008, which constituted a more than 1% increase from the 19,827 inventions disclosed in FY2007, and a more than 6% increase from the 18,874 inventions disclosed in FY2006.  Start-ups by survey respondents were also up, albeit slightly, from 3,381 in FY2007 to 3,388 in FY2008.

As for patent grants, the survey showed that the number of patents issued to survey respondents dropped from 3,622 in FY2007 to 3,280 in FY2008 -- a 9% decline.  (With respect to the AUTM survey, the high water mark for issued patents came in FY2003, when respondents secured 3,933 patents.)  The most recent survey also showed a 9% drop in new products introduced, down from 686 in FY2007 to 648 in FY2008, and a 5% decline in licenses, down from 4,354 in FY2007 to 4,144 in FY2008.

The AUTM FY2008 U.S. Licensing Survey can be obtained here (at a cost of $60).

Biogen Idec Receives Method-of-Use Patent on Human ß-Interferon

Implications for Patent Protection for Avonex® Anti-Multiple Sclerosis Drug

    By Kevin E. Noonan --

There is a tendency to blame the process when an undesired outcome occurs.  That is happening in the wake of regulatory filings with the Securities and Exchange Commission regarding U.S. Patent 7,588,755 (the '755 patent), issued on September 15, 2009, and owned by Biogen Idec.  The undesired outcome (by some) is the possibility that this patent will protect Biogen Idec's blockbuster multiple sclerosis drug, Avonex® (human interferon beta 1a), from generic competition for an additional 13 years (until September 15, 2026) after expiration of current patents in May 2013.  That may happen, but a review of the history of the application shows that the patenting process worked as it is supposed to, with no evidence that Biogen Idec was not diligent in prosecuting this application within Patent Office rules.  If anything, it is the diligence with which the Office examined the application that resulted in the delay that may extend Biogen Idec's exclusivity period.

The '755 patent claims priority to a first application filed in 1981 and a divisional application filed in 1989, both abandoned.  The application that resulted in the '755 patent was filed on May 25, 1995, and thus has a patent term of 17 years from issue, determined by U.S. law prior to the adoption of the GATT provision limiting U.S. patent term to 20 years from the earliest priority date.  A history of patent prosecution reveals "why it took so long" for this patent to issue:

The longest period of delay extended from March 12, 1998 to January 15, 2003 -- almost five years -- while prosecution was suspended because of a potential interference.  (For those uninitiated in the arcane world of interferences, the most likely reason for this delay was to give a potential interfering application time to be prosecuted until interfering claims were deemed allowable.)  As it turns out, no interference was declared, and the Examiner renewed prosecution by asserting anticipation rejections based on two patents to Sugano (U.S. Patent Nos. 5,514,567 or 5,326,859).  (Ironically, '755 patent applicant Fiers was involved in an earlier interference against Sugano, and a second party, Revel, almost 20 years ago, in which Sugano prevailed in claims for human ß-interferon.)  The second extensive period of delay involved the appeal of the asserted anticipation rejection, which was complicated by the new formalities rules for appeal briefs promulgated (and strictly enforced) by the Office.  This delayed prosecution of the application to allowance by another 3 years, from June 24, 2005 to May 29, 2008.  Ultimately, the Board of Patent Appeals and Interferences reversed the rejections based on the Sugano patents, paving the way for allowance and issue of the '755 patent (a process that took another 16 months).

In addition to these Patent Office delays, the extended term of this patent is, of course, an artifact of the change in patent term in the U.S. -- the reason the term seems so long today is that we have become accustomed to a 20-year maximum from the earliest priority date, and the prior norm of 17 years from grant date seems anomalous, especially when the term is as extended as it is in this case (31 years from the application filing date, and 45 years from the earliest priority date).  Something like this could not occur today.

Besides these procedural aspects, whether the '755 patent will be useful for preventing generic competition for Avonex® will depend on the scope of the granted claims.  The '755 patent has but three claims, set forth below:

1.  A method for immunomodulation or treating a viral conditions, a viral disease, cancers or tumors comprising the step of administering to a patient in need of such treatment a therapeutically effective amount of a composition comprising:
    a recombinant polypeptide produced by a non-human host transformed by a recombinant DNA molecule comprising a DNA sequence selected from the group consisting of:
    (a) DNA sequences which are capable of hybridizing to any of the DNA inserts of G-pBR322(Pst)/HFIF1, G-pBR322(Pst)/HFIF3 (DSM 1791), G-pBR322(Pst)/HFIF6 (DSM 1792), and G-pBR322(Pst)/HFIF7 (DSM 1793) under hybridizing conditions of 0.75 M NaCl at 68.degree. C. and washing conditions of 0.3 M NaCl at 68.degree. C., and which code for a polypeptide displaying antiviral activity, and (b) DNA sequences which are degenerate as a result of the genetic code to the DNA sequences defined in (a);
    said DNA sequence being operatively linked to an expression control sequence in the recombinant DNA molecule.

2.  The method according to claim 1, wherein said DNA sequence is selected from DNA sequences of the formulae:

ATGACCAACAAGTGTCTCCTCCAAATTGCTCTCCTGTTGTGCTTCTCCACTA
CAGCTCTTTCCATGAGCTACAACTTGCTTGGATTCCTACAAAGAAGCAGCAA
TTTTCAGTGTCAGAAGCTCCTGTGGCAATTGAATGGGAGGCTTGAATACTGC
CTCAAGGACAGGATGAACTTTGACATCCCTGAGGAGATTAAGCAGCTGCAGC
AGTTCCAGAAGGAGGACGCCGCATTGACCATCTATGAGATGCTCCAGAACAT
CTTTGCTATTTTCAGACAAGATTCATCTAGCACTGGCTGGAATGAGACTATT
GTTGAGAACCTCCTGGCTAATGTCTATCATCAGATAAACCATCTGAAGACAG
TCCTGGAAGAAAAACTGGAGAAAGAAGATTTCACCAGGGGAAAACTCATGAG
CAGTCTGCACCTGAAAAGATATTATGGGAGGATTCTGCATTACCTGAAGGCC
AAGGAGTACAGTCACTGTGCCTGGACCATAGTCAGAGTGGAAATCCTAAGGA
ACTTTTACTTCATTAACAGACTTACAGGTTACCTCCGAAAC,

and

ATGAGCTACAACTTGCTTGGATTCCTACAAAGAAGCAGCAATTTTCAGTGTC
AGAAGCTCCTGTGGCAATTGAATGGGAGGCTTGAATACTGCCTCAAGGACAG
GATGAACTTTGACATCCCTGAGGAGATTAAGCAGCTGCAGCAGTTCCAGAAG
GAGGACGCCGCATTGACCATCTATGAGATGCTCCAGAACATCTTTGCTATTT
TCAGACAAGATTCATCTAGCACTGGCTGGAATGAGACTATTGTTGAGAACCT
CCTGGCTAATGTCTATCATCAGATAAACCATCTGAAGACAGTCCTGGAAGAA
AAACTGGAGAAAGAAGATTTCACCAGGGGAAAACTCATGAGCAGTCTGCACC
TGAAAAGATATTATGGGAGGATTCTGCATTACCTGAAGGCCAAGGAGTACAG
TCACTGTGCCTGGACCATAGTCAGAGTGGAAATCCTAAGGAACTTTTACTTC
ATTAACAGACTTACAGGTTACCTCCGAAAC.

3.  The method according to claim 1 wherein the polypeptide is selected from polypeptides of the formulae:

Met-Thr-Asn-Lys-Cys-Leu-Leu-Gln-Ile-Ala-Leu-Leu-
Leu-Cys-Phe-Ser-Thr-Thr-Ala-Leu-Ser-Met-Ser-Tyr-
Asn-Leu-Leu-Gly-Phe-Leu-Gln-Arg-Ser-Ser-Asn-Phe-
Gln-Cys-Gln-Lys-Leu-Leu-Trp-Gln-Leu-Asn-Gly-Arg-
Leu-Glu-Tyr-Cys-Leu-Lys-Asp-Arg-Met-Asn-Phe-Asp-
Ile-Pro-Glu-Glu-Ile-Lys-Gln-Leu-Gln-Gln-Phe-Gln-
Lys-Glu-Asp-Ala-Ala-Leu-Thr-Ile-Tyr-Glu-Met-Leu-
Gln-Asn-Ile-Phe-Ala-Ile-Phe-Arg-Gln-Asp-Ser-Ser-
Ser-Thr-Gly-Trp-Asn-Glu-Thr-Ile-Val-Glu-Asn-Leu-
Leu-Ala-Asn-Val-Tyr-His-Gln-Ile-Asn-His-Leu-Lys-
Thr-Val-Leu-Glu-Glu-Lys-Leu-Glu-Lys-Glu-Asp-Phe-
Thr-Arg-Gly-Lys-Leu-Met-Ser-Ser-Leu-His-Leu-Lys-
Arg-Tyr-Tyr-Gly-Arg-Ile-Leu-His-Tyr-Leu-Lys-Ala-
Lys-Glu-Tyr-Ser-His-Cys-Ala-Trp-Thr-Ile-Val-Arg-
Val-Glu-Ile-Leu-Arg-Asn-Phe-Tyr-Phe-Ile-Asn-Arg-
Leu-Thr-Gly-Tyr-Leu-Arg-Asn,

and

Met-Ser-Tyr-Asn-Leu-Leu-Gly-Phe-Leu-Gln-Arg-Ser-
Ser-Asn-Phe-Gln-Cys-Gln-Lys-Leu-Leu-Trp-Gln-Leu-
Asn-Gly-Arg-Leu-Glu-Tyr-Cys-Leu-Lys-Asp-Arg-Met-
Asn-Phe-Asp-Ile-Pro-Glu-Glu-Ile-Lys-Gln-Leu-Gln-
Gln-Phe-Gln-Lys-Glu-Asp-Ala-Ala-Leu-Thr-Ile-Tyr-
Glu-Met-Leu-Gln-Asn-Ile-Phe-Ala-Ile-Phe-Arg-Gln-
Asp-Ser-Ser-Ser-Thr-Gly-Trp-Asn-Glu-Thr-Ile-Val-
Glu-Asn-Leu-Leu-Ala-Asn-Val-Tyr-His-Gln-Ile-Asn-
His-Leu-Lys-Thr-Val-Leu-Glu-Glu-Lys-Leu-Glu-Lys-
Glu-Asp-Phe-Thr-Arg-Gly-Lys-Leu-Met-Ser-Ser-Leu-
His-Leu-Lys-Arg-Tyr-Tyr-Gly-Arg-Ile-Leu-His-Tyr-
Leu-Lys-Ala-Lys-Glu-Tyr-Ser-His-Cys-Ala-Trp-Thr-
Ile-Val-Arg-Val-Glu-Ile-Leu-Arg-Asn-Phe-Tyr-Phe-
Ile-Asn-Arg-Leu-Thr-Gly-Tyr-Leu-Arg-Asn.

The relevance of these claims to Avonex® will depend on whether Avonex® administration falls within the ambit of the method claim, which requires:

a)  immunomodulation or
b)  treating a viral condition, a viral disease, cancers or tumors
c)  administering to a patient in need of such treatment
d)  a therapeutically effective amount of a composition comprising:
e)  a recombinant polypeptide
f)  produced by a non-human host transformed by a recombinant DNA molecule comprising a DNA sequence
g)  encoding human ß-interferon or sequence homolog thereof
h)  which code for a polypeptide displaying antiviral activity

While elements e) through h) are apparently encompassed by Avonex®, whether these claims will be useful for precluding generic entry will depend on whether treatment of MS involves immunomodulation or viral disease (since it is self-evidently neither cancer or a tumor).  In this regard the scientific literature is littered with reports linking MS with a variety of viral infections (including Epstein-Barr virus and measles virus), but no definitive linkage has been established.  While MS treatment is likely to involve some type of immunomodulation, Biogen Idec would have the burden of establishing such a mechanism should they sue an ANDA filer for infringement.

The importance of the question about the scope of this patent, and its effects on generic competition over Avonex® can be appreciated from the sales figures for the drug in the second quarter of 2009, which amount to almost $600 million (or $2.4 billion per year), according to an Associated Press article cited in Forbes magazine.

As the Forbes article suggests, the outcome of the Avonex® patent regime has relevance to the current follow-on biologics legislation, at least because of the emotional appeal regarding the length of patent protection.  Understanding the history of this patent defuses any apprehension about the likelihood of similar outcomes going forward, and the Avonex® patent estate can be seen to be nothing more than a historical accident that cannot be replicated.  However, the tendency for dissatisfaction with outcomes like this one to guide political activity, and legislation, should not be underestimated.

ABA Issues Opinion on Outsourcing

    By Donald Zuhn --

On Monday, the American Bar Association (ABA) Standing Committee on Ethics and Professional Responsibility released a statement regarding a new ethics opinion (Formal Opinion 08-451), which concludes that U.S. lawyers can outsource legal and nonlegal work provided that they adhere to ethics rules regarding competence, supervision, protection of confidential information, reasonable fees, and not assisting in the unauthorized practice of law.  The opinion, entitled "Lawyer’s Obligations When Outsourcing Legal and Nonlegal Support Services," outlines the ethics obligations of lawyers and firms that wish to utilize legal and nonlegal outsourcing.

Stating that "[a] lawyer may outsource legal or nonlegal support services provided the lawyer remains ultimately responsible for rendering competent legal services to the client," the opinion notes that lawyers and law firms engage lawyers and nonlawyers for various legal and nonlegal support services, ranging from "the use of a local photocopy shop for the reproduction of documents, to the retention of a document management company for the creation and maintenance of a database for complex litigation, . . . or even to the engagement of a group of foreign lawyers to draft patent applications."  The opinion acknowledges, however, that "[t]he challenge for an outsourcing lawyer is . . . to ensure that tasks are delegated to individuals who are competent to perform them, and then to oversee the execution of the project adequately and appropriately."

Notwithstanding the ABA opinion -- and its reference to the outsourcing of patent application drafting to foreign lawyers -- the U.S. Patent and Trademark Office recently reminded patent practitioners that the export of subject matter abroad pursuant to a USPTO-issue foreign filing license is limited to purposes related to the filing of foreign patent applications, and that the foreign filing license does not authorize exporting of subject matter abroad for the preparation of patent applications to be filed in the United States (see "PTO Issues Notice on Scope of Foreign Filing Licenses").  As the USPTO noted, U.S. patent practitioners wishing to outsource patent application drafting to foreign lawyers are not without recourse, as these practitioners can contact the Bureau of Industry and Security (BIS) at the Commerce Department in order to secure the appropriate clearances.

Thus, while the new ABA ethics opinion permits U.S. lawyers to outsource legal support services to foreign lawyers, patent practitioners would be wise to, at a minimum, refrain from outsourcing the drafting of patent applications to foreign lawyers.  Patent practitioners who intend to outsource other types of legal support tasks (e.g., document review) are advised to consult the ABA opinion before doing so.

Docs at BIO: Panel Discusses IP Strategies after KSR

    By Donald Zuhn --

Last week, a panel of biopharma attorneys participated in a breakout session at the BIO International Convention to discuss the impact of the Supreme Court's decision in KSR Int'l Co. v. Teleflex Inc. on biopharma patent prosecution and litigation.  Participating in the panel, entitled "Biopharma IP Strategies in the Post-KSR World," were Eric Marandett, a Partner at Choate, Hall & Stewart LLP; Kerry Flynn, Vice President, Intellectual Property and Licensing for Shire Human Genetic Therapies, Inc.; Dr. Christine Bellon, Senior Patent Counsel and Director of Intellectual Property for Infinity Pharmaceuticals, Inc.; and Dr. Hans Sauer, the Associate General Counsel of the Biotechnology Industry Organization.

Dr. Bellon began the discussion by reviewing six pharma obviousness decisions issued in the past fifteen months:

1.  Pfizer, Inc. v. Apotex, Inc. (Fed. Cir. 2007)
2.  Takeda Chem. Indus., Ltd. v. Alphapharm Pty., Ltd. (Fed. Cir. 2007)
3.  Forest Labs., Inc. v. Ivax Pharm., Inc. (Fed. Cir. 2007)
4.  Aventis Pharma Deutschland GmbH v. Lupin, Ltd. (Fed. Cir. 2007)
5.  Ortho-McNeil Pharma., Inc. v. Mylan Labs., Inc. (Fed. Cir. 2008)
6.  Altana Pharma AG v. Teva Pharma. USA, Inc. (D. N.J. 2007)

As we reported in March, the first four cases are being used (along with seven other obviousness cases) in Group 1600 to teach examiners how to examine applications for obviousness (see "USPTO's Bruce Kisliuk Addresses ACI Conference").  Patent Docs has provided summaries of all but the Altana Pharma case (a summary of that case will be provided in the coming week).

Contrasting the Pfizer and Forest Labs. decisions, Mr. Marandett observed that while 53 anions were found to be a finite number of solutions in the pre-KSR Pfizer case, two enantiomers did not constitute a "finite number of identified, predictable solutions" in Forest Labs.  He also contended that Ortho-McNeil Pharma. was an interesting case because the Federal Circuit determined that the use of a flexible TSM test comports with KSR.  According to Mr. Marandett, the Federal Circuit likely recognizes that the Supreme Court will be reluctant to take another obviousness case, and therefore in Ortho-McNeil Pharma., the CAFC has begun to test the boundaries of KSR.  Finally, Mr. Marandett contended that the cases above show that each of the Graham secondary considerations is merely the "tail that wags the dog," since these considerations seem to be applied only when they produce the result desired by the court.

Dr. Sauer next turned the discussion to two biotech obviousness decisions:  Pharmastem Therapeutics, Inc. v. Viacell, Inc. (Fed. Cir. 2007) and Ex parte Kubin (B.P.A.I. 2007), each of which has been previously discussed by Patent Docs.  According to Dr. Sauer, Pharmastem Therapeutics constituted a "plain vanilla" obviousness case (i.e., a combination invention case) that could be decided just as "harshly" as KSR.  In Kubin, however, the question is whether the classical rules of chemical obviousness law (i.e., whether there is structural similarity between new and old compounds; whether there is some teaching that would have led the skilled artisan to look to the new compound) still apply, or whether the Federal Circuit will determine that KSR mandates that the availability of a routine method renders a new compound obvious.  While these classical chemical rules were applied in In re Deuel, Dr. Sauer acknowledges that in the intervening years between Deuel and Kubin, "we've had the KSR case and technology has advanced."  Nevertheless, Dr. Sauer seemed to be leaning towards a reversal in Kubin (which is perhaps not surprising, given that BIO submitted an amicus brief in support of Amgen; see "Briefs for In re Kubin filed by Amgen and BIO").

Ms. Flynn concluded the panel discussion by presenting some interesting statistics on obviousness cases.  With respect to obviousness decisions rendered in the past eight years, Ms. Flynn noted that a University of Houston Law Center study (www.patstats.org) had produced the following results:

With respect to recent biopharma obviousness cases, Ms. Flynn stated that 30 decisions have been issued since KSR (16 pharma cases and 14 biotech cases).  In those cases, the patentee prevailed 60.9% of the time and the accused infringer prevailed 39.1% of the time.  Thus, the outlook for biopharma patentees may not be as bleak as it would first appear to be.

For additional information on this and other related topics, please see:

• "Docs at BIO: "Gotcha" Games Continue at USPTO," June 25, 2008
• "Docs at BIO: Panel Discusses Impact of USPTO Rules Changes and Patent Reform Legislation on Biotech Patenting," June 23, 2008
• "Docs at BIO: Representatives from JPO, EPO, SIPO, and USPTO Discuss Recent Developments in Japan, Europe, China, and the U.S.," June 22, 2008
• "Docs at BIO: Steve Burrill's State of the Biotechnology Industry Report 2008," June 19, 2008

Second Viread® Patent Survives Reexamination

    By Donald Zuhn --

Yesterday, Gilead Sciences, Inc. announced that the U.S. Patent and Trademark Office had issued a Notice of Intent to Issue an Ex Parte Reexamination Certificate for U.S. Patent No. 5,922,695.  The '695 patent became the second of Gilead's four Viread® (tenofovir disoproxil fumarate) patents to survive reexamination.  Last month, Gilead announced that U.S. Patent No. 6,043,230 had also survived reexamination.  Still in reexamination proceedings are Gilead's U.S. Patent Nos. 5,977,089 and 5,935,946.

The four reexamination proceedings were initiated in response to an ex parte reexamination request filed by the Public Patent Foundation (PUBPAT) on March 23, 2007.  While PUBPAT has devoted a page on its website to the Viread® patents, it has not yet posted a comment concerning either of the Patent Office's determinations regarding the '695 and '230 patents.

In the Notice of Intent issued with respect to the '695 patent, the Patent Office indicated that the patentee had overcome a 102(a) rejection of claim 1 over one reference by submitting a Rule 131 declaration showing that the inventors had prepared bis (isopropyloxy carbonyloxymethyl) PMPA in the United States prior to January 1997.  The Office also explained that a 103(a) rejection in view of three references and the patentee's own admission had been overcome by the patentee's arguments made during reexamination proceedings.  The Office further indicated that the patentee had established that bis carbonate prodrugs of PMPA are unexpectedly stable and useful, these prodrugs have satisfied a long felt need in the anti-HIV drug art, and that the invention is commercially successful.

The '695 patent is directed to a compound comprising an antiviral phosphonomethoxy nucleotide analog and the '230 patent is directed to a method comprising contacting a cell with such a compound.  In the company's press relaease, Gilead Senior Vice President and General Counsel Gregg Alton noted that the '695 patent was "the most integral to Viread's novel exclusivity," and stated that the company was "pleased with the PTO's swift analyses and actions, which have confirmed the strength of [Gilead's] patent position."

On Gilead's Viread® homepage, the drug is described as being a member of the nucleoside reverse transcriptase inhibitor (NRTI or "nuke") family of molecules.  Viread®, which helps to block reverse transcriptase by interfering with the replication process (as shown in an animation on the Viread® homepage), can be used in combination with other HIV medications for the treatment of HIV-1 infection.

USPTO to Reexamine ExonHit Therapeutics Patent

    By Donald Zuhn --

Last month, Larkspur, California-based biotech Jivan Biologics, Inc. announced that the U.S. Patent and Trademark Office had granted its request for an ex parte reexamination of U.S. Patent No. 6,881,571, which is owned by ExonHit Therapeutics S.A.  The '571 patent is directed to devices for identifying differentially spliced gene products.  ExonHit, which is based in Paris, France, had originally asserted the '571 patent against Jivan in an infringement suit filed in the U.S. District Court for the Northern District of California on March 12, 2007 (see complaint here).

In its Order granting the reexamination, the Patent Office stated that Jivan, in a request filed in mid-March, had identified nine references each of which raised a substantial new question of patentability.  Independent claims 1 and 12 of the '571 patent recite:

1.  A device for identifying at least one differentially spliced gene product, wherein said device comprises a solid support material and single-stranded oligonucleotides of between 5 and 100 nucleotides in length attached to said support material, wherein said oligonucleotides comprise at least a first and a second oligonucleotide molecule arranged serially on the support material, wherein said first oligonucleotide molecule comprises a first sequence that is complementary to and specific for an exon or an intron of a first gene, and wherein said first sequence corresponds to a region of variability in at least one product of said first gene due to differential splicing, and wherein said second oligonucleotide molecule comprises a second sequence that is complementary to and specific for an exon-exon or exon-intron junction region of said first gene, and wherein said second sequence corresponds to a region of variability in at least one product of said first gene due to differential splicing, said device allowing, when contacted with a sample containing at least one nucleic acid molecule under conditions allowing hybridisation to occur, the determination of the presence or absence of said differentially spliced gene product.

12.  A method of producing a device comprising a support material and single-stranded oligonucleotide of between 5 and 100 nucleotides in length attached to said solid support material, wherein said method comprises: (a) providing said oligonucleotides, wherein said oligonucleotides comprise at least a first and a second oligonucleotide molecule, wherein said first oligonucleotide molecule comprises a first sequence that is complementary to and specific for an exon or an intron of a first gene, and wherein said first sequence corresponds to a region of variability in at least one product of said first gene due to differential splicing, and wherein said second oligonucleotide molecule comprises a second sequence that is complementary to and specific for an exon-exon or exon-intron junction region of said first gene, and wherein said second sequence corresponds to a region of variability in at least one product of said first gene due to differential splicing; and (b) arranging and immobilizing said oligonucleotides serially on said support material, said device allowing, when contacted with a sample containing at least one nucleic acid molecule under conditions allowing hybridisation to occur, the determination of the presence or absence of at least one differentially spliced gene product.

In its press release, Jivan CEO Dr. Subha Srinivasan stated that the company was "pleased to hear that the USPTO has decided to reexamine the validity of this patent," and expected that the Office would either require ExonHit to amend the claims or invalidate the claims in their entirety.

Patent Hypocrisy

    By Kevin E. Noonan --

The so-called Coalition for Patent Fairness has been one of the principal voices lobbying Congress for the now-becalmed Senate "patent reform bill (S. 1145) and the House version of the bill (H.R. 1938), passed last September.  The Coalition is comprised of "high technology" companies like Apple, Cisco, Intel, Microsoft, Sun Microsystems, and others, and its message is decidedly patent-unfriendly.  Patents harm innovation, subject productive companies to nuisance lawsuits by patent trolls, and the Republic would be much better off if there was a lot less patenting, according to the Coalition.

Unless we start talking about them, of course.  The extent to which these companies eschew the childhood adage "what's sauce for the goose is sauce for the gander" is clearly set forth in a report, released today, from the Intellectual Property Owners.  That report contains a numerical ranking of the companies that own the most patents granted in 2007.  The extent of the rhetorical impact of the Coalition's lobbying can be seen in the somewhat pathetic disclaimer in the report that "IPO DOES NOT INTEND TO ENCOURAGE MORE PATENTING IN THE U.S." (emphasis in original).  Not unnecessary patenting, or frivolous patenting, but all patenting.  A remarkable statement for an organization comprised of intellectual property owners.  The report lists the top 300 organizations that were granted U.S. patents in 2007, and a related Patent Docs post discusses the biotech and pharma companies on the list.  Here, we will concentrate on those organizations having 1,000 issued patents in 2007.

It is unlikely the results presented in the report would be found in a world in which peoples' behavior matched their political positions.  Since that is clearly not the world we live in, these top patent procurers should come as no surprise:

It is notable that several Coalition members have found their way on the list, and that they continue to have thousands of published applications, in view of their efforts to reduce the effectiveness of U.S. patents.

Also notable in this list is the predominance of companies headquartered outside the U.S.  These companies are not a part of the Coalition, and apparently believe that the U.S. patent system is robust enough to justify their considerable investment in filing patent applications in this country.  Even though they are no less subject to the vicissitudes of U.S. patent litigation or the other ills supposedly besetting high technology companies in the U.S.  The contrast is ironic:  the strengthening of the U.S. patent system is one of the factors that permitted nascent U.S. high technology companies to compete in the 1980's with Japanese and German companies that were at the zenith of their market penetration in the U.S.  The success of the nurturing the patent system provided then can be seen on any street corner now:  iPods, not Walkmans.  In view of their rhetoric and behavior, it seems that there is a childhood adage the member companies of the Coalition subscribe to:  eating your cake and having it too.

ETC Group Opposes "Climate Ready" Gene Patent "Grab"

    By Donald Zuhn --

Last week, both The Washington Post and Nature News reported on the efforts of biotech companies to secure patents directed to gene-altered crops that are designed to withstand the effects of global warming.  The impetus behind both articles was a 30-page report entitled "Patenting the 'Climate Genes' . . . and Capturing the Climate Agenda," which was released by the Erosion, Technology and Concentration (ETC) Group, an activist organization based in Ottawa, Ontario, on May 13th.  (Patent Docs readers are no doubt familiar with the ETC Group, as we have reported on a few of the Group's other initiatives; see links below.)

According to the ETC Group, biotech and agrochemical companies such as BASF, Monsanto, Bayer, Syngenta, and Dupon have been "stockpiling hundreds of monopoly patents on genes in plants," and that the companies intend to market genetically engineered crops containing such genes (i.e., "climate ready" plants) as being able to withstand environmental stresses such as drought, heat, cold, floods, and saline soils.  The ETC Group contends that the above companies have thus far filed 532 patent applications worldwide (in 55 patent families) on such genes, and warns that "[i]n the face of climate chaos and a deepening world food crisis, the Gene Giants are gearing up for a PR offensive to re-brand themselves as climate saviours."  The Group argues, however, that "patented techno-fix seeds will not provide the adaptation strategies that small farmers need to cope with climate change," and that the so-called "Gene Giants" are merely engaging in "climate change profiteering."

To prevent such "profiteering," the ETC Group is pushing for a worldwide suspension of patent grants for climate-related genes and traits.  The Group hopes that such action might be taken at either the U.N. Convention on Biological Diversity on May 19-30 or the United Nations-FAO High-Level Conference on World Food Security and the Challenges of Climate Change and Bioenergy on June 3-5, and that following the implementation of such a suspension, world governments would initiate an investigation into the social and environmental impact of patents directed to climate ready genes and plants.  The ETC Group is also urging "inter-governmental bodies to identify and eliminate policies such as restrictive seed laws, intellectual property regimes, contracts and trade agreements that are barriers to farmer plant breeding, seed-saving and exchange."

Not surprisingly, the companies accused by the ETC Group of engaging in "climate change profiteering" see their role in a much different light.  According to The Washington Post article, the biotech companies seeking gene patents contend that climate ready plants will be critical to solving the problem of world hunger and that absent patent protection, such plants will not be developed.  In addition, a spokesperson for Monsanto noted in the Post report that Monsanto and BASF were participating in a project, funded by the Bill and Melinda Gates Foundation, to develop drought-resistant corn that would be made available to African farmers royalty-free.

One of the ETC Group's criticisms regarding the 532 filed applications is that these applications contain claims that are far too broad, encompassing numerous plants and a litany of environmental stresses.  However, because the vast majority of these applications have yet to issue as patents, the actual claim scope that the applicants will be able to secure remains unclear.  ETC Group executive director Pat Mooney concedes this point in the Nature News article, admitting that "the companies are casting the net as wide as they possibly can, and then they will sort it out afterwards."

Dr. Alan Bennett (at left), a plant geneticist at the University of California, Davis and the head of the the Public Intellectual Property Resource for Agriculture (PIPRA), a non-profit initiative supporting agricultural innovation for both humanitarian and small-scale commercial purposes, put the debate between the ETC Group and the agricultural-biotech industry  into some perspective in the Nature News report.  Calling the introduction of the global warming angle nothing more than a public relations stunt, Dr. Bennett observed that the agricultural-biotech industry was merely engaging in business as usual; namely, focusing on the search for hardy crops that survive in harsher environments (i.e., poor soils, less water, fewer fertilizers), and the genes responsible for conferring such traits.

For additional information regarding other related topics, please see:

• "Playing the Bioterror Card in the Synthetic Biology Debate," December 19, 2007
• "The Synthetic Biology Sky is Not Falling," December 16, 2007
• "Patent Life (Really)," June 11, 2007

IPO Disagrees with Director Dudas

    By Kevin E. Noonan --

As reported by Patent Docs on April 30th, Jon Dudas (at right), Undersecretary of Commerce and Director of the U.S. Patent and Trademark Office, has a message for the public (and Congress, and the courts and particularly the patent community):  one of the problems that ails the Patent Office is that "[w]e [the Patent Office] are getting more and more unpatentable ideas, worse and worse quality applications."  His "evidence":  falling allowance rates, which he asserts dates from about 2003, when the allowance rate was about 70%, until now when the allowance rate is less than 50%.  This is convenient, because it roughly correlates with the beginnings of the examination backlog that began under his watch and has gotten steadily worse under his leadership.  This even while Congress has (for the past 4 fiscal years) reversed a twenty-year trend of raiding Patent Office receipts to fund other parts of the federal government.  The Patent Office is getting full funding, and hiring thousands of new examiners, and yet it still can't reduce the backlog of pending applications.  The Office's answer, as it has been for several years, is that patent applicants and the patent bar are to blame (see "New Rules, New Threats: More on the Office of Enrollment and Discipline").  The reason used to be a proliferation of continuation applications and RCEs (before Judge Cacheris enjoined the ill-advised "new rules" designed to reduce the backlog by precluding applicants from filing more than two continuations in an application family).  Now the mantra is "quality" (which ranks with the flag, motherhood, and apple pie in the Patent Office pantheon) and the Patent Office cannot "do its job" because of these "poor quality" applications.

On May 6th, the Intellectual Property Owners Association (IPO) joined the ranks of those understanding these Patent Office pronouncements for what they are:  desperate attempts to shift the blame for the application backlog to anyone other than the managers whose incompetence is actually to blame.  In a letter to Mr. Dudas, the IPO stated it was "not aware" of any such quality decline.  The IPO reminds the Director that IPO members file almost 30% of all U.S. patent applications by U.S. citizens, and "take patent quality very seriously."  The IPO also reminds the Director that, as an organization, the topic of patent quality "is a regular subject of discussion within IPO committees and at public conferences attended by our members."

The IPO's letter also reminds the Director what the other side of the Patent Office's mouth has been saying for several months:  that the reduction in the allowance rate was not because patent quality has declined, but because patent examination quality has increased (see "USPTO Announces 'Record Breaking' 2007 Performance").  In addition, the letter specifically cites comments at a public conference on March 17, 2008 by the former Chief Administrative Patent Judge of the Board of Appeals and Interferences, that "it was not clear" (presumably to the Office) why patent allowance rates were falling.  However, the artificial "abandonments" recorded with the filing of Requests for Continued Examination ("RCEs") were mentioned by the Judge as a possible reason.  Considering this rationale, it appears reasonable that RCEs may be contributing to the statistic, especially if "patent quality" initiatives were resulting in a decrease in the number of allowances and an increase in the time and number of Office Actions needed to reach agreement with Examiners about the scope of patentable subject matter in an application.

The IPO's letter also points out, accurately, that declining allowance rates today occur in applications filed several years ago, in view of the time it takes for an application to be examined (which, by the Patent Office's own measurements were, on average, 31.9 months in 2007).  And if there is a basis for "declining quality," according to the IPO, it may reside in the greater number of prior art citations applicants make today than they did in the past, in an effort to forestall inequitable conduct allegations when patentees attempt to enforce patent rights.

The IPO closes its letter with a challenge:

Therefore, we request that the USPTO share the data it has to support the proposition that the quality of applications submitted to the office is declining.  If the data does indeed support this position, IPO would be very interested in working with the USPTO to improve application quality, consistent with keeping the responsibility for examining patent applications with the office and not transferring it to patent applicants.  As you are aware, we oppose legislation mandating "Applicant Quality Submissions," but we remain willing to explore voluntary actions that could be taken by patent applicants to reverse any demonstrated decline in the quality of submitted applications.

The challenge is likely to fall on deaf ears, since Mr. Dudas' comments were not intended to address an actual problem.  No, the answer to "bad quality" patents is easy:  don't allow them.  If they are of particularly poor quality, or don't claim a patentable invention, it should be easy to continue to reject them without expense or extensive Patent Office resources.  And these applications, if pursued, will continue to be a boon to patent examiners, who can continue to exploit the antiquated "count" system with these applications and allocate more time to other applications containing patentable subject matter.

Thus, Mr. Dudas' comments are yet another Patent Office straw man raised to deflect attention from the real root of the problem:  mismanagement.  The management problem exacerbated the lack of funding that started the Office down this path at a time of great technological advances in several scientific and industrial fields.  This was coupled with changes in what was considered within the scope of patentable subject matter, and with Patent Office rule changes (like publication) that created strong incentives for applicants to file new, continuing, and divisional applications before these rule changes went into effect in the fall of 2000.  As a consequence of all these factors, the Office (as well as patent offices worldwide) experienced a large increase in the number of applications, an application "bubble," that is the true "cause" of the application backlog.  Instead of pointing fingers, the more productive approach would be to accept the IPO's invitations (and others like it from other groups and organizations in the patent community) to join with the Office in an attempt to solve these problems, rather than merely assessing blame.  Perhaps the next Administration will be able to field a Patent Office team capable of doing so.

For additional information on this topic, please see:

• "New York Times to Innovation: Drop Dead," April 30, 2008

Pfizer's Lipitor '893 Patent Survives Reexamination

    By Donald Zuhn --

On Wednesday, Pfizer announced that it had received a Notice of Intent to Issue an Ex Parte Reexamination Certificate for U.S. Patent No. 4,681,893 from the U.S. Patent and Trademark Office.  The '893 patent, which expires in March 2010, is directed in part to atorvastatin, the active ingredient in Pfizer's cholesterol-reducing drug Lipitor®.  Pfizer noted that "it is pleased with the decision, which affirms the company’s position that the patent was properly granted."

The reexamination request (Reexamination No. 90/008,727) was filed by Ranbaxy Laboratories Ltd. in July 2007.  Ranbaxy had sought reexamination of the '893 patent after waging an unsuccessful battle to invalidate the patent in federal court; in August 2006, the Federal Circuit affirmed a District Court finding that Ranbaxy had infringed the '893 patent (while also reversing the District Court and finding another Pfizer atorvastatin patent, U.S. Patent No 5,273,995, invalid).

In the Notice of Intent's Statement of Reasons for Patentability and/or Confirmation, the Examiner indicated that Pfizer had overcome obviousness rejections based on European Publication No. EP 0 179 559 and U.S. Patent No. 4,647,576.  With respect to the '559 publication, Pfizer submitted a Declaration establishing that the '559 publication has the same inventor as the '893 patent, is therefore not by "another," and as a result is no longer available as prior art under 35 U.S.C. § 102(a).  With respect to the '576 patent, the Examiner determined that neither the '576 patent, nor any of the other prior art cited by Ranbaxy, would have led a chemist to substitute the carboalkoxy of the closest prior art compound (described in the '576 patent) with the carboxamide of atorvastatin of the '893 patent.  Quoting Takeda Chem. Indus., Ltd. v. Alphapharm Pty., Ltd., the Examiner noted that "in cases involving new chemical compounds, it remains necessary to identify some reason that would have led a chemist to modify a known compound in a particular manner to establish prima facie obviousness of a new claimed compound."  With respect to the reexamination of the '893 patent, the Examiner determined that no such reason existed.

A second request for ex parte reexamination (Reexamination No. 90/009,048) filed by Ranbaxy on February 22, 2008 was denied by the Patent Office on April 9, 2008.

StemCells' Patents Survive Reexam -- StemCells and Neuralstem Differ on Extent of Changes

    By Donald Zuhn --

Last week, StemCells, Inc. announced that the U.S. Patent and Trademark Office had issued Notices of Intent to Issue Ex Parte Reexamination Certificates with respect to the Palo Alto-based biotech company's U.S. Patent Nos. 5,851,832 and 6,497,872.  The '832 patent, entitled "In vitro growth and proliferation of multipotent neural stem cells and their progeny," is directed to a method for preparing a population of mammalian neural cells enriched with multipotent neural stem cells.  The '872 patent, entitled "Neural transplantation using proliferated multipotent neural stem cells and their progeny," is directed to a method of transplanting multipotent neural stem cell progeny into a host.

In its statement, StemCells contended that the USPTO had upheld the patents, which the company exclusively licenses, "with only minor amendments, thereby rejecting the arguments raised by Neuralstem, Inc. in its reexamination petitions of last year."  StemCells noted that the '832 and '872 patents are two of four patents that StemCells asserted in a 2006 patent infringement suit against Neuralstem, Inc. of Rockville, MD.

In response, Neuralstem filed a Request for Ex Parte Reexamination in April 2007 for each of the asserted patents.  On April 1, 2008, the Patent Office issued a Notice of Intent to Issue an Ex Parte Reexamination Certificate in Reexamination No. 90/008,581, which concerned the '872 patent, and on April 9th, the Office issued a Notice of Intent in Reexamination No. 90/008,580, which concerned the '832 patent.

StemCells President and CEO Martin McGlynn stated that the Patent Office's issuance of the Notices of Intent "preserves intact the basis of [StemCells'] infringement action against Neuralstem,” adding that, "the Patent Office has reconfirmed the ground-breaking nature of the inventions claimed in these patents, which are part of our multi-layered patent portfolio."  Mr. McGlynn predicted that the Office would issue similar decisions on the remaining two patents, allowing StemCells to "move ahead expeditiously" with its suit against Neuralstem.

In response to StemCells' announcement, Neuralstem released a statement of its own.  According to Neuralstem's release, StemCells "completely mischaracterized the meaning of the US Patent and Trademark Office's most recent action."  Neuralstem President and CEO Richard Garr asserted that in order to secure the Notices of Intent, StemCells was forced to make "numerous substantial amendments," and that these amendments "completely destroy any basis for [StemCells'] assertions of infringement by Neuralstem."  Mr. Garr added that "any attempt by [StemCells] to reopen their baseless law suit will be unsuccessful [since] Neuralstem does not infringe upon any of their 'old' claims, nor do we infringe upon any of the significantly modified claims that they salvaged in the reexamination process."

Claim 1 of the '832 patent, as issued on December 22, 1998, reads:

1.  A method for preparing a population of mammalian neural cells enriched with multipotent neural stem cells comprising:
    (a) obtaining a population of mammalian neural cells which contains at least one multipotent neural stem cell capable of producing progeny that are capable of differentiating into neurons and glia, including astrocytes;
    (b) preparing a culture medium containing one or more predetermined growth factors capable of inducing multipotent neural stem cell proliferation; and
    (c) combining the population of mammalian neural cells obtained in (a) with the culture medium prepared in (b) and culturing said mammalian neural cells under conditions that allow the proliferation of said at least one multipotent neural stem cell to produce multipotent neural stem cell progeny which includes daughter multipotent neural stem cells to produce a cell culture that contains a percentage of multipotent neural stem cells that is at least ten fold higher than that of said population of mammalian neural cells obtained in (a).

In the Statement of Reasons for Patentability, the Examiner noted that claim 1 was patentable in view of the patentee's amendments to recite "non-immortalized, human neural cells" rather than "mammalian neural cells" in step (a), "serum free culture media" instead of "culture media" in step (b), and "undifferentiated multipotent neural stem cell progeny" rather than "multipotent neural stem cell progeny" in step (c).  Similar amendments were made to other claims that were at issue.

Claim 1 of the '872 patent, as issued on December 24, 2002, reads:

1.  A method of transplanting multipotent neural stem cell progeny to a host comprising:
    (a) obtaining a population of cells derived from mammalian neural tissue containing at least one multipotent CNS neural stem cell, said neural stem cell under suitable culture conditions producing progeny that differentiate into neurons that express neuron specific enolase or neurofilament and glia that express glial fibrillary acidic protein or express galactocerebroside;
    (b) culturing the neural stem cell in (a) in a culture medium containing one or more growth factors which under suitable culture conditions induces multipotent neural stem cell proliferation;
    (c) inducing proliferation of said multipotent neural stem cell to produce neural stem cell progeny which includes multipotent neural stem cell progeny cells; and
    (d) transplanting said multipotent neural stem cell progeny to said host.

In the '581 reexamination, the Examiner noted that claim 1 was patentable in view of the patentee's amendments to recite "a human host" instead of a "host" as well as, inter alia, the recitation of "human neural tissue" instead of "mammalian neural tissue" in step (a), "serum-free culture medium" instead of "culture medium" in step (b), and "undifferentiated human neural stem cell progeny" rather than "neural stem cell progeny" in step (c).

Claim Drafting: Examples of Recently Issued Antibody Claims

    By Jason Derry --

Claim drafting is somewhat of an art that takes time and practice to learn.  Practitioners typically develop various styles and formats over time.  One of the best ways to assist in developing good claim drafting skills is to be mindful of the types of claims that are being issued by the U.S. Patent and Trademark Office that relate to particular fields of interest.  For example, a claim drafter may use issued claims as models and templates to facilitate prosecution to avoid many 35 U.S.C. § 112 rejections that might otherwise arise.  In addition, the drafter may be able to maximize claim scope by covering more aspects of an invention in dependent claims by modeling the claim sets others have successfully prosecuted to issuance.  Practitioners are likely to develop their own style of claim drafting by monitoring and studying issued claims, as different claim language can be used to cover similar subject matter.

From time to time, Patent Docs will provide examples of issued claims from different biotechnology oriented fields.  We provide these examples as a resource for our readers' reference and consideration.  We will not provide much in the way of analysis or comments on the patents themselves, and will not study prosecution histories, unless otherwise noted.  We will provide some comments on the format of the claims, and reference support for various aspects of claims where appropriate.

This week we highlight an example of recently issued claims that cover antibodies claimed by reference to a binding target.

U.S. Patent No. 7,348,414, issued March 25, 2008 to Genentech Inc., claims an antibody that binds to a particular polypeptide identified by sequence.

Claim 1 of the '414 patent reads as follows:

1. An isolated antibody that specifically binds to the polypeptide of SEQ ID NO:464.

The '414 patent has dependent claims directed to antibody fragments, monoclonal antibodies, humanized antibodies, and labeled antibodies, as follows:

2. The antibody of claim 1 which is a monoclonal antibody.

3. The antibody of claim 1 which is a humanized antibody.

4. An antigen-binding fragment of the antibody of claim 1.

5. The antibody of claim 1 which is labeled.

The patent does not provide any actual examples of such antibodies that bind to SEQ ID NO:464, but does provide definitions and discusses general teachings from the art relating to antibody generation.  The patent also provides a prophetic example (Example 10) that discusses how to generate monoclonal antibodies of the invention.

Thus, the '414 patent provides an example of claiming antibodies to a newly discovered protein, even in the absence of having generated any actual antibodies that bind to that protein.  The allowance of such claims is consistent with current USPTO practice in view of Noelle v Lederman, 355 F.3d 1343, 1349 (Fed. Cir. 2004) (see "The Evolution of the Written Description Requirement in the Context of Biotechnological Inventions" for a brief discussion of Noelle v. Lederman with respect to written description relative to antibody claiming).

Jason Derry, Ph.D., who graduated with honors from DePaul University College of Law, is a molecular biologist and founding author of Patent Docs.

StemCellPatents.com Launches New Stem Cell Patent Database

    By Donald Zuhn --

StemCellPatents.com has announced the launch of a newly redesigned stem cell patent database.  A beta version of the database was launched in November 2006.  The stem cell patent database will extend the site's other offerings, which include online news, a weekly e-mail newsletter, the SCP Journal, and a jobs board.

According to a BusinessWire report, the new database contains "comprehensive summaries and analysis of over 1200 patents hand-picked by experts in the field to be of relevance to stem cell commercialization and development."  As of Thursday, the stem cell patent database included summaries and bibliographic information for 1,269 U.S. patents relating to stem cells.

Dr. Vladimir Bogin, and member of the site's advisory board and a principle of Cromos Pharma Services, observed that while the media has lately focused its attention on WARF's embryonic stem cell patents, the "minefield of issued patents in the area of stem cell therapy" has been grossly underestimated by the industry.  Dr. Bogin noted that by compiling the stem cell patent database, the website hoped to let investigators know "what is out there and what is not, with the hope of accelerating commercialization and, in turn, progress."  Other members of the site's advisory board include Don McAdam, the CEO of MBVax Corporation, and Dr. Zhoahui Zhong, a Professor of Medicine at that Hunan Medical University in Changsha, China.

New Website Creates Place to Examine the Examiners

    By Donald Zuhn --

USPTO Examiners, a website that bills itself as a place to "examine the examiners," recently opened its (virtual) doors for business.  While the site's creator (or creators) have yet to be identified, the same may no longer be true for some examiners at the U.S. Patent and Trademark Office.  According to the site's "About Us" page, USPTO Examiners was created so that patent practitioners and inventors would have a place where they could review, rank, and investigate USPTO examiners.  The site encourages practitioners and inventors who have interacted with an examiner to report on their experiences with that examiner, including their opinions about the examiner's knowledge of the law and technology and the examiner's accessibility.  The website contends that the website's "online collaborative environment" will eventually prove to be a valuable resource in crafting prosecution strategy for particular applications.  As of Thursday evening, two comments (one good and one bad) had been posted regarding two different examiners (one allegedly good and one allegedly "downright cruel").

Yes, It IS Time (Finally) to Stop the Hypocrisy over Human Stem Cell Patents

    By Kevin E. Noonan --

The two remaining ex parte re-examinations (35 U.S.C. § 302-307) of Wisconsin Alumni Research Foundation (WARF) stem cell patents -- Control No. 90/008102 for U.S. Patent No. 5,843,780 (claiming primate embryonic stem (pES) cells) and Control No. 90/008139 for U.S. Patent No. 6,200,806 (claiming human embryonic stem cell (hES) cells) -- have been decided, and the U.S. Patent and Trademark Office has determined that the claims of these patents are patentable, after all.  These decisions are a stunning victory for WARF, and a crushing defeat for the Public Patent Foundation (PUBPAT), headed by Dan Ravicher, and the Foundation for Taxpayer and Consumer Rights (FTCR), a California taxpayer group (which recently became ConsumerWatchdog.org).

Unlike the 85-page decision announcing the patentability of WARF's U.S. Patent No. 7,029,913 in an inter partes re-examination (35 U.S.C. § 311-318) proceeding (see "(Finally) It May Be Time to Stop the Hypocrisy over Stem Cell Patents"), the Office dispensed with these two challenges much more parsimoniously.  In re-examination of the '780 patent, the original grounds of rejection asserted by the Examiner were as follows:

• That claims 1-11 were unpatentable under 35 U.S.C. § 102(b) for being anticipated by U.S. Patent No. 5,166,065 to Williams.
• That claims 1-8 and 11 were unpatentable under 35 U.S.C. § 103(a) for being obvious in light of the '065 patent.
• That claims 1-8 were unpatentable under 35 U.S.C. § 102(b) for being anticipated by U.S. Patent No. 5,690,926 to Hogan.
• That claims 1-8 were unpatentable under 35 U.S.C. § 103(a) for being obvious in light of the '926 patent.
• That claim 11 was unpatentable under 35 U.S.C. § 102(b) for being anticipated by Bongso et al., 1994, Hum. Reprod. 9: 2110-17 (see "WARF Responds to the Patent Office on Its Re-examined Stem Cell Patents").
• That claim 11 was unpatentable under 35 U.S.C. § 103(a) for being obvious in light of the Bongso reference.
• That claims 1-11 were unpatentable under 35 U.S.C. § 103(a) for being obvious in light of Robertson '83 (Cold Spring Harbor 10: 647-63), the Robertson '87 reference (Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, IRL Press), or Piedrahita et al., 1990, Theriogenology 34: 879-901, taken alone or in combination with the '065 and '926 patents.

In the communication mailed on Tuesday, all these grounds of rejection were withdrawn and the claims as amended by the patentee were deemed patentable.  Amended claims 1, 3, 9 and 11 and added new claims 12-14 read as follows:

1.  A purified preparation of pluripotent primate embryonic stem cells derived from preimplantation embryos wherein the stem cells (i) will proliferate in an in vitro culture for over one year in an undifferentiated state, (ii) maintain a karyotype in which all the chromosomes characteristic of the primate species are present and not noticeably altered through prolonged culture, (iii) maintain the potential to differentiate into derivatives of endoderm, mesoderm, and ectoderm tissues throughout the culture, and (iv) will not differentiate when cultured on a fibroblast feeder layer.

3.  A purified preparation of primate embryonic stem cell line wherein the cells of the cell line are negative for the SSEA-1 marker, positive for the SSEA-3 marker, positive for the SSEA-4 marker, express alkaline phosphatase activity, are pluripotent, and have karyotypes which includes the presence of all of the chromosomes characteristic of the primate species and in which none of the chromosomes are noticeably altered.

9.  A method of isolating a pluripotent primate embryonic stem cell line, the method comprising the steps of:
    (a) isolating a primate blastocyst;
    (b) isolating cells from the inner cell mass of the blastocyst of (a);
    (c) plating the inner cell mass cells on embryonic fibroblasts, wherein inner cell mass-derived cells masses are formed;
    (d) dissociating the mass into dissociated cells;
    (e) replating the dissociated cells on embryonic feeder cells;
    (f) selecting colonies with compact morphologies and cells with high nucleus to cytoplasm ratios and prominent nucleoli; and
    (g) culturing the cells of the selected colonies to produce an isolated pluripotent primate embryonic stem cell line that is capable of proliferating as undifferentiated cells for over one year.

11.  A cell line that is capable of proliferation for over one year developed by the method of claim 9.

12.  A method of isolating a pluripotent primate embryonic stem cell line, the method comprising the steps of:
    (a) isolating a primate blastocyst;
    (b) isolating cells from the inner cell mass of the blastocyst of (a);
    (c) plating the inner cell mass cells on embryonic fibroblasts, wherein inner cell mass-derived cells masses are formed;
    (d) dissociating the mass into dissociated cells;
    (e) replating the dissociated cells on embryonic feeder cells;
    (f) selecting colonies with compact morphologies that are flatter than mouse embryonic stem cell colonies, wherein the cells with high nucleus to cytoplasm ratios and prominent nucleoli; and
    (g) culturing the cells of the selected colonies to produce an isolated pluripotent primate embryonic stem cell line that is capable of proliferating as undifferentiated cells for over one year.

13.  A method as claimed in claim 12, further comprising maintaining the isolated cells on a fibroblast feeder layer to prevent differentiation.

14.  A cell line that is capable of proliferation for over one year as undifferentiated cells developed by the method of claim 12.

The Examiner made these determinations in the Statement of Reasons for Patentability:

U.S. Patent No. 5,166,056 to Williams does not anticipate the '780 patent claims because the Williams patent disclosed only mouse ES cells and did not inherently enable the hES cells claimed in the '780 patent.  Moreover, any implied teaching with regard to hES cells was contradicted by a later paper (Cherny and Williams, 1994, Reprod. Fert. Develop. 6: 569-75), stating that the methods of isolating mouse embryonic stem cells "would not extend" to methods for isolating human pluripotent ES cells.  The Williams '065 patent also did not disclose primate ES cells that differ from mouse ES cells in the expression of markers like SSEA-1, nor do the mouse ES cells differentiate into trophoblast when induced to differentiate.  The Williams '065 patent was limited to mouse ES cells.  Moreover, the Examiner believed that undue experimentation would be required to practice the methods of the Williams patent to produce hES cells, since there could be no reasonable expectation of success in view of all of the evidence of record.

Turning to the '926 patent, the Examiner determined that the EG cells disclosed by Hogan are distinct from the ES cells claimed in the '780 patent, because: (1) they were derived from post-implantation embryos; (2) the Hogan EG cells are SSEA-1 positive; and (3) the Hogan EG cells do not differentiate into trophoblast when differentiation is induced.  The Examiner, therefore, found that the '926 patent neither anticipates nor renders obvious the claims of the 780 patent.  In addition, the methods used by Hogan would not render obvious the ES cells obtained from pre-implantation embryos.  Finally, the Examiner found that the degree of unpredictability in producing hES cells having the properties of the hES cells claimed in the '780 patent precluded the reasonable expectation of success required to support an obviousness determination.

The Examiner determined that the Bongso reference (Ariff Bongso at right) did not teach pluripotent embryonic stem cells that proliferate for over one year in an undifferentiated state (noting that the cells produced by Bongso either differentiated into fibroblasts or died after the second culture passage), nor did they exhibit the other characteristic features of the hES cells claimed in the '780 patent.  Moreover, a Declaration from the '780 patent inventor, James Thomson, established that Thomson had invented his ES cells prior to the November 1994 publication date of the Bongso reference.

Finally, the Examiner considered whether the combination of the Robertson '83 reference, the Robertson '87 reference, or the Piedrahita reference, either alone or in combination with the '065 patent and the '926 patent, rendered the '780 patent obvious.  He found that while the two Robertson references disclosing mouse ES cells taught methods for producing mouse ES cells, the Piedrahita reference failed to isolate ES cells from pigs or sheep and showed that the methods used to produce mouse ES cells were not applicable to other mammals and indeed, taught away from applying techniques used in mice in other mammals.  The combination thus did not render obvious the claims of the '780 patent.  The Examiner came to the same conclusion with regard to the combination of these references with the teachings of the '065 patent and the '926 patent.

In re-examination of the '806 patent, the Robertson '83, Robertson '87, Piedrahita, and Bongso references, and Williams '065 and Hogan '926 patents were applied to the claims, as well as U.S. Patent 5,453,357 to Hogan; Behrouz et al., 2005 (Current Opinion in Biotechnology 16: 530-535), and Cruz et al., 1991 (Current Communications 4: 147-204).  The Notice expressly defined the terms "stem cells," "embryonic stem cells," "pluripotent," and "true ES cells."

With respect to the '806 patent, the Examiner withdrew the following grounds of rejection:

• That claims 1-8 and 11 were unpatentable under 35 U.S.C. § 102(e) for being anticipated by the '926 or '357 patents alone, or as further evidenced by the '806 patent disclosure demonstrating inherency.
• That claim 11 was unpatentable under 35 U.S.C. § 102(a) for being anticipated by the Bongso reference.
• That claim 11 was unpatentable under 35 U.S.C. § 103(a) for being obvious in light of the Bongso reference.
• That claims 1-11 were unpatentable under 35 U.S.C. § 102(b) for being anticipated by the '065 patent.
• That claims 1-11 were unpatentable under 35 U.S.C. § 103(a) for being obvious in light of the '065 patent.
• That claims 1-11 were unpatentable under 35 U.S.C. § 103(a) for being obvious in light of the Robertson '83 reference, Robertson '87 reference, or Piedrahita reference, taken alone or in combination with the '065 and '926 patents.

The amended claims of the '806 patent read as follows:

1.  A purified preparation of pluripotent human embryonic stem cells derived from preimplantation embryos wherein the stem cells (i) will proliferate in an in vitro culture for over one year in an undifferentiated state, (ii) maintain a karyotype in which the chromosomes are euploid and not altered through prolonged culture, (iii) maintain the potential to differentiate into derivatives of endoderm, mesoderm, and ectoderm tissues throughout the culture, and (iv) are inhibited from differentiation when cultured on a fibroblast feeder layer.

3.  A purified preparation of primate embryonic stem cell line wherein the cells of the cell line are negative for the SSEA-1 marker, positive for the SSEA-3 marker, positive for the SSEA-4 marker, express alkaline phosphatase activity, are pluripotent, and have euploid karyotypes and in which none of the  chromosomes are altered.

9.  A method of isolating a pluripotent primate embryonic stem cell line, comprising the steps of:
    (a) isolating a human blastocyst;
    (b) isolating cells from the inner cell mass of the blastocyst of (a);
    (c) plating the inner cell mass cells on embryonic fibroblasts, wherein inner cell mass-derived cells masses are formed;
    (d) dissociating the mass into dissociated cells;
    (e) replating the dissociated cells on embryonic feeder cells;
    (f) selecting colonies with compact morphologies and cells with high nucleus to cytoplasm ratios and prominent nucleoli; and
    (g) culturing the cells of the selected colonies the thereby obtain an isolated pluripotent human embryonic stem cell line that is capable of proliferation as undifferentiated cells for over one year.

11.  A cell line that is capable of proliferation for over one year developed by the method of claim 9.

12.  A method of isolating a pluripotent human embryonic stem cell line, the method comprising the steps of:
    (a) isolating a human blastocyst;
    (b) isolating cells from the inner cell mass of the blastocyst of (a);
    (c) plating the inner cell mass cells on embryonic fibroblasts, wherein inner cell mass-derived cells masses are formed;
    (d) dissociating the mass into dissociated cells;
    (e) replating the dissociated cells on embryonic feeder cells;
    (f) selecting colonies with compact morphologies that are flatter than mouse embryonic stem cell colonies, wherein the cells with high nucleus to cytoplasm ratios and prominent nucleoli; and
    (g) culturing the cells of the selected colonies to produce an isolated pluripotent human embryonic stem cell line that is capable of proliferating as undifferentiated cells for over one year.

13.  A method as claimed in claim 12, further comprising maintaining the isolated cells on a fibroblast feeder layer to prevent differentiation.

14.  A cell line that is capable of proliferation for over one year as undifferentiated cells developed by the method of claim 12.

The Examiner found that neither the Hogan '926 nor Hogan '357 patents taught hES cells that did not express SSEA-1 on the cell surface, were derived from preimplantation embryos or could be derived from human blastocysts.  The inherent expression of SSEA-1 was considered a marker that the hES cells claimed in the '806 patent were patentably distinct from Hogan's EG cells.  The Examiner cited the Behrouz reference in support of this distinction.  The Examiner also found that the Bongso reference did not anticipate Claim 11, since Bongso's cells had none of the proliferation properties of the hES cells encompassed by the claims.  In addition, a Declaration by the inventor established an earlier date of invention prior to the publication date of the Bongso reference.

Turning to the Williams '065 patent, the Examiner found that both the prosecution history of the patent (wherein the Examiner had required Williams to limit the claims from "animal" ES cells to mouse ES cells), and the Cherney-Williams reference showed that the Williams '065 patent was not enabling for the hES cells claimed in the '806 patent.  Finally, the Examiner determined that the combination of the Robertson '83 reference, Robertson '87 reference, or Piedrahita reference, taken alone or in combination with the '065 and '926 patents did not "engender a reasonable expectation of success" in producing the hES cells claimed in the '806 patent.

The Examiner also expressly set forth the evidence for and against a prima facie obviousness case originally raised against the '806 patent claims.  On the side of non-obviousness, the Examiner found that "the prior art of record neither discloses nor contained an enabling suggestion of how to make true hES cells or cell lines without the necessity for undue experimentation."  Thus, despite a high level of ordinary skill in the art, "there was no reasonable expectation of successfully isolating true hES cells or cell lines" using methods successful in mice, "given the highly unpredictable nature of the prior art."

The Examiner noted that as of the priority date of the '806 application (January 20, 1995), no one had reported isolating a hES cell line, despite the fact that rodent (mouse, hamster, and rat) ES cell lines had been isolated and their properties characterized.  The Examiner also noted the unique features of the hES cells claimed in the '806 patent:  permanent, euploid, embryo-derived cell lines that could differentiate into all three embryonic germ cell layers.  The Examiner also cited the combination of the success taught by the Robertson references with regard to mouse ES cells, and the failures described in the Piedrahita reference in attempting to apply these teachings to ES cells from other mammalian species.  The Examiner cites the Cruz reference on the differences between ES cells from different mammalian species, which supports the non-obviousness determination.  Finally, the Examiner uses the Hogan '926 patent as evidence that the art recognized the difficulty in producing hES cells, and thus turned to primordial germ cells (EG cells) as an alternative.

The Examiner also cited the evidence of failure of others and the "wide acclaim" Dr. Thomson received from his peers as objective indicia of non-obviousness.

The evidence supporting the obviousness determination, on the other hand, was principally the declaration submitted by Dr. Jeanne Loring (see "It's Time to Stop the Hypocrisy over Stem Cell Patents - Part III").  In addition, Professor Loring (at right) testified to conversations with Dr. Hogan and Dr. Iannaccone "regarding putative or actual attempts at obtaining hES cells from blastocysts using the same techniques disclosed in the Robertson references" relating to mouse ES cells.  The Examiner opined that "little weight" should be given Dr. Loring's declaration evidence "since it states opinion on the ultimate legal issue [obviousness] without providing sufficient underlying factual support."  The Examiner also gave little weight to the "uncorroborated conversations" Dr. Loring putatively had with other experts, "when considered in light of all the documentary evidence of record."

Balancing the factual evidence, the Examiner concluded that the '806 patent claims were not obvious.

These decisions cannot be appealed by the third party requestor, since their active involvement ended when the ex parte re-examination was declared (although they were served with all papers between the Patent and Trademark Office and WARF during the pendency of the re-examination).  Since neither PUBPAT nor FTCR are practicing the claimed invention, they have no standing to ask a District Court for a declaratory judgment of invalidity, and such a judgment should only be harder to obtain in view of the results of these re-examinations.

This is good news for WARF and Professor Thomson, who can now get back to his research on making pluripotent stem cells from fibroblasts, a more robust and less ethically and politically controversial procedure.  After trumpeting as victories the initial (and expected) Office Action rejections issued by the Patent Office in these re-examinations, perhaps PUBPAT and FTCR will be more prudent and circumspect about the "bad" patents it chooses to attack.  After all, they have to be out there, don't they?

For information regarding this and other related topics, please see:

• "(Finally) It May Be Time to Stop the Hypocrisy over Stem Cell Patents," February 28, 2008
• "WARF Licenses Stem Cell Patent Portfolio to BioTime," January 23, 2008
• "It's Time to Stop the Hypocrisy over Stem Cell Patents - Part III," July 4, 2007
• "WARF Responds to the Patent Office on Its Re-examined Stem Cell Patents," June 26, 2007
• "It's Time to Stop the Hypocrisy over Stem Cell Patents - Part II," April 26, 2007
• "It's Time to Stop the Hypocrisy over Stem Cell Patents - Part I," April 17, 2007
• "WARF Stem Cell Patent Claims Rejected in Re-examination," April 3, 2007