Patent Docs

Biogen Idec Receives Method-of-Use Patent on Human ß-Interferon

Implications for Patent Protection for Avonex® Anti-Multiple Sclerosis Drug

    By Kevin E. Noonan --

There is a tendency to blame the process when an undesired outcome occurs.  That is happening in the wake of regulatory filings with the Securities and Exchange Commission regarding U.S. Patent 7,588,755 (the '755 patent), issued on September 15, 2009, and owned by Biogen Idec.  The undesired outcome (by some) is the possibility that this patent will protect Biogen Idec's blockbuster multiple sclerosis drug, Avonex® (human interferon beta 1a), from generic competition for an additional 13 years (until September 15, 2026) after expiration of current patents in May 2013.  That may happen, but a review of the history of the application shows that the patenting process worked as it is supposed to, with no evidence that Biogen Idec was not diligent in prosecuting this application within Patent Office rules.  If anything, it is the diligence with which the Office examined the application that resulted in the delay that may extend Biogen Idec's exclusivity period.

The '755 patent claims priority to a first application filed in 1981 and a divisional application filed in 1989, both abandoned.  The application that resulted in the '755 patent was filed on May 25, 1995, and thus has a patent term of 17 years from issue, determined by U.S. law prior to the adoption of the GATT provision limiting U.S. patent term to 20 years from the earliest priority date.  A history of patent prosecution reveals "why it took so long" for this patent to issue:

The longest period of delay extended from March 12, 1998 to January 15, 2003 -- almost five years -- while prosecution was suspended because of a potential interference.  (For those uninitiated in the arcane world of interferences, the most likely reason for this delay was to give a potential interfering application time to be prosecuted until interfering claims were deemed allowable.)  As it turns out, no interference was declared, and the Examiner renewed prosecution by asserting anticipation rejections based on two patents to Sugano (U.S. Patent Nos. 5,514,567 or 5,326,859).  (Ironically, '755 patent applicant Fiers was involved in an earlier interference against Sugano, and a second party, Revel, almost 20 years ago, in which Sugano prevailed in claims for human ß-interferon.)  The second extensive period of delay involved the appeal of the asserted anticipation rejection, which was complicated by the new formalities rules for appeal briefs promulgated (and strictly enforced) by the Office.  This delayed prosecution of the application to allowance by another 3 years, from June 24, 2005 to May 29, 2008.  Ultimately, the Board of Patent Appeals and Interferences reversed the rejections based on the Sugano patents, paving the way for allowance and issue of the '755 patent (a process that took another 16 months).

In addition to these Patent Office delays, the extended term of this patent is, of course, an artifact of the change in patent term in the U.S. -- the reason the term seems so long today is that we have become accustomed to a 20-year maximum from the earliest priority date, and the prior norm of 17 years from grant date seems anomalous, especially when the term is as extended as it is in this case (31 years from the application filing date, and 45 years from the earliest priority date).  Something like this could not occur today.

Besides these procedural aspects, whether the '755 patent will be useful for preventing generic competition for Avonex® will depend on the scope of the granted claims.  The '755 patent has but three claims, set forth below:

1.  A method for immunomodulation or treating a viral conditions, a viral disease, cancers or tumors comprising the step of administering to a patient in need of such treatment a therapeutically effective amount of a composition comprising:
    a recombinant polypeptide produced by a non-human host transformed by a recombinant DNA molecule comprising a DNA sequence selected from the group consisting of:
    (a) DNA sequences which are capable of hybridizing to any of the DNA inserts of G-pBR322(Pst)/HFIF1, G-pBR322(Pst)/HFIF3 (DSM 1791), G-pBR322(Pst)/HFIF6 (DSM 1792), and G-pBR322(Pst)/HFIF7 (DSM 1793) under hybridizing conditions of 0.75 M NaCl at 68.degree. C. and washing conditions of 0.3 M NaCl at 68.degree. C., and which code for a polypeptide displaying antiviral activity, and (b) DNA sequences which are degenerate as a result of the genetic code to the DNA sequences defined in (a);
    said DNA sequence being operatively linked to an expression control sequence in the recombinant DNA molecule.

2.  The method according to claim 1, wherein said DNA sequence is selected from DNA sequences of the formulae:

ATGACCAACAAGTGTCTCCTCCAAATTGCTCTCCTGTTGTGCTTCTCCACTA
CAGCTCTTTCCATGAGCTACAACTTGCTTGGATTCCTACAAAGAAGCAGCAA
TTTTCAGTGTCAGAAGCTCCTGTGGCAATTGAATGGGAGGCTTGAATACTGC
CTCAAGGACAGGATGAACTTTGACATCCCTGAGGAGATTAAGCAGCTGCAGC
AGTTCCAGAAGGAGGACGCCGCATTGACCATCTATGAGATGCTCCAGAACAT
CTTTGCTATTTTCAGACAAGATTCATCTAGCACTGGCTGGAATGAGACTATT
GTTGAGAACCTCCTGGCTAATGTCTATCATCAGATAAACCATCTGAAGACAG
TCCTGGAAGAAAAACTGGAGAAAGAAGATTTCACCAGGGGAAAACTCATGAG
CAGTCTGCACCTGAAAAGATATTATGGGAGGATTCTGCATTACCTGAAGGCC
AAGGAGTACAGTCACTGTGCCTGGACCATAGTCAGAGTGGAAATCCTAAGGA
ACTTTTACTTCATTAACAGACTTACAGGTTACCTCCGAAAC,

and

ATGAGCTACAACTTGCTTGGATTCCTACAAAGAAGCAGCAATTTTCAGTGTC
AGAAGCTCCTGTGGCAATTGAATGGGAGGCTTGAATACTGCCTCAAGGACAG
GATGAACTTTGACATCCCTGAGGAGATTAAGCAGCTGCAGCAGTTCCAGAAG
GAGGACGCCGCATTGACCATCTATGAGATGCTCCAGAACATCTTTGCTATTT
TCAGACAAGATTCATCTAGCACTGGCTGGAATGAGACTATTGTTGAGAACCT
CCTGGCTAATGTCTATCATCAGATAAACCATCTGAAGACAGTCCTGGAAGAA
AAACTGGAGAAAGAAGATTTCACCAGGGGAAAACTCATGAGCAGTCTGCACC
TGAAAAGATATTATGGGAGGATTCTGCATTACCTGAAGGCCAAGGAGTACAG
TCACTGTGCCTGGACCATAGTCAGAGTGGAAATCCTAAGGAACTTTTACTTC
ATTAACAGACTTACAGGTTACCTCCGAAAC.

3.  The method according to claim 1 wherein the polypeptide is selected from polypeptides of the formulae:

Met-Thr-Asn-Lys-Cys-Leu-Leu-Gln-Ile-Ala-Leu-Leu-
Leu-Cys-Phe-Ser-Thr-Thr-Ala-Leu-Ser-Met-Ser-Tyr-
Asn-Leu-Leu-Gly-Phe-Leu-Gln-Arg-Ser-Ser-Asn-Phe-
Gln-Cys-Gln-Lys-Leu-Leu-Trp-Gln-Leu-Asn-Gly-Arg-
Leu-Glu-Tyr-Cys-Leu-Lys-Asp-Arg-Met-Asn-Phe-Asp-
Ile-Pro-Glu-Glu-Ile-Lys-Gln-Leu-Gln-Gln-Phe-Gln-
Lys-Glu-Asp-Ala-Ala-Leu-Thr-Ile-Tyr-Glu-Met-Leu-
Gln-Asn-Ile-Phe-Ala-Ile-Phe-Arg-Gln-Asp-Ser-Ser-
Ser-Thr-Gly-Trp-Asn-Glu-Thr-Ile-Val-Glu-Asn-Leu-
Leu-Ala-Asn-Val-Tyr-His-Gln-Ile-Asn-His-Leu-Lys-
Thr-Val-Leu-Glu-Glu-Lys-Leu-Glu-Lys-Glu-Asp-Phe-
Thr-Arg-Gly-Lys-Leu-Met-Ser-Ser-Leu-His-Leu-Lys-
Arg-Tyr-Tyr-Gly-Arg-Ile-Leu-His-Tyr-Leu-Lys-Ala-
Lys-Glu-Tyr-Ser-His-Cys-Ala-Trp-Thr-Ile-Val-Arg-
Val-Glu-Ile-Leu-Arg-Asn-Phe-Tyr-Phe-Ile-Asn-Arg-
Leu-Thr-Gly-Tyr-Leu-Arg-Asn,

and

Met-Ser-Tyr-Asn-Leu-Leu-Gly-Phe-Leu-Gln-Arg-Ser-
Ser-Asn-Phe-Gln-Cys-Gln-Lys-Leu-Leu-Trp-Gln-Leu-
Asn-Gly-Arg-Leu-Glu-Tyr-Cys-Leu-Lys-Asp-Arg-Met-
Asn-Phe-Asp-Ile-Pro-Glu-Glu-Ile-Lys-Gln-Leu-Gln-
Gln-Phe-Gln-Lys-Glu-Asp-Ala-Ala-Leu-Thr-Ile-Tyr-
Glu-Met-Leu-Gln-Asn-Ile-Phe-Ala-Ile-Phe-Arg-Gln-
Asp-Ser-Ser-Ser-Thr-Gly-Trp-Asn-Glu-Thr-Ile-Val-
Glu-Asn-Leu-Leu-Ala-Asn-Val-Tyr-His-Gln-Ile-Asn-
His-Leu-Lys-Thr-Val-Leu-Glu-Glu-Lys-Leu-Glu-Lys-
Glu-Asp-Phe-Thr-Arg-Gly-Lys-Leu-Met-Ser-Ser-Leu-
His-Leu-Lys-Arg-Tyr-Tyr-Gly-Arg-Ile-Leu-His-Tyr-
Leu-Lys-Ala-Lys-Glu-Tyr-Ser-His-Cys-Ala-Trp-Thr-
Ile-Val-Arg-Val-Glu-Ile-Leu-Arg-Asn-Phe-Tyr-Phe-
Ile-Asn-Arg-Leu-Thr-Gly-Tyr-Leu-Arg-Asn.

The relevance of these claims to Avonex® will depend on whether Avonex® administration falls within the ambit of the method claim, which requires:

a)  immunomodulation or
b)  treating a viral condition, a viral disease, cancers or tumors
c)  administering to a patient in need of such treatment
d)  a therapeutically effective amount of a composition comprising:
e)  a recombinant polypeptide
f)  produced by a non-human host transformed by a recombinant DNA molecule comprising a DNA sequence
g)  encoding human ß-interferon or sequence homolog thereof
h)  which code for a polypeptide displaying antiviral activity

While elements e) through h) are apparently encompassed by Avonex®, whether these claims will be useful for precluding generic entry will depend on whether treatment of MS involves immunomodulation or viral disease (since it is self-evidently neither cancer or a tumor).  In this regard the scientific literature is littered with reports linking MS with a variety of viral infections (including Epstein-Barr virus and measles virus), but no definitive linkage has been established.  While MS treatment is likely to involve some type of immunomodulation, Biogen Idec would have the burden of establishing such a mechanism should they sue an ANDA filer for infringement.

The importance of the question about the scope of this patent, and its effects on generic competition over Avonex® can be appreciated from the sales figures for the drug in the second quarter of 2009, which amount to almost $600 million (or $2.4 billion per year), according to an Associated Press article cited in Forbes magazine.

As the Forbes article suggests, the outcome of the Avonex® patent regime has relevance to the current follow-on biologics legislation, at least because of the emotional appeal regarding the length of patent protection.  Understanding the history of this patent defuses any apprehension about the likelihood of similar outcomes going forward, and the Avonex® patent estate can be seen to be nothing more than a historical accident that cannot be replicated.  However, the tendency for dissatisfaction with outcomes like this one to guide political activity, and legislation, should not be underestimated.

In re '318 Patent Infringement Litigation (Fed. Cir. 2009)

    By Donald Zuhn --

Last week, a divided panel of the Federal Circuit affirmed a determination by the District Court for the District of Delaware that the claims of U.S. Patent No. 4,663,318 were invalid for lack of enablement.  The '318 patent, which issued on May 5, 1987 from U.S. Application No. 06/819,141, is directed to a method for treating Alzheimer’s disease with galanthamine.  The lone independent claim of the '318 patent recites:

1.  A method of treating Alzheimer's disease and related dementias which comprises administering to a patient suffering from such a disease a therapeutically effective amount of galanthamine or a pharmaceutically-acceptable acid addition salt thereof.

The majority opinion notes that at the time the '141 application was filed (January 1986), researchers had observed a correlation between Alzheimer’s disease symptoms and a reduced level of the neurotransmitter acetylcholine in the brain (acetylcholine is released by a transmitting neuron and binds to nicotinic receptors and muscarinic receptors on a receiving neuron).  The majority opinion also notes that at the time the '141 application was filed, the small molecule galanthamine (at right; also known as galantamine) was known to inhibit acetylcholinesterase, an enzyme that breaks down acetylcholine.  The majority opinion states that the specification for the '318 patent is "only just over one page in length" and provides "almost no basis for its stated conclusion that it was possible to administer 'an effective Alzheimer's disease cognitively-enhancing amount of galanthamine.'"  The majority opinion also states that the specification provides "short summaries" of six scientific papers in which galanthamine had been administered to humans or animals, but "did not provide analysis or insight connecting the results of any of these six studies to galanthamine's potential to treat Alzheimer's disease in humans" or "refer to any then-existing animal test results involving the administration of galantamine in connection with this animal model of Alzheimer's disease."

During prosecution of the '318 patent, the examiner rejected the claims for indefiniteness and obviousness.  In attempting to overcome the rejection, the inventor, Dr. Bonnie Davis, informed the Patent Office that "experiments [are] underway using animal models which are expected to show that treatment with galanthamine does result in an improvement in the condition of those suffering from Alzheimer's disease," and that it was "expected that data from this experimental work will be available in two to three months and will be submitted to the Examiner promptly thereafter."  The majority opinion notes that the results of these experiments were not known until July 1987, after the '318 patent issued, that the studies "required several months and considerable effort by researchers at the Johns Hopkins University," and that the results were never submitted to the Patent Office.  In November 1995, Dr. Davis licensed the '318 patent to Plaintiffs-Appellants Janssen Pharmaceutica N.V., Janssen L.P., and Synaptech, Inc. (Janssen).

Seeking approval to market a generic version of Janssen's galanthamine-based therapeutic for treating mild to moderate Alzheimer's disease, several generic drug manufacturers filed Abbreviated New Drug Applications (ANDAs) with the FDA.  In response, Janssen filed infringement suits against each ANDA filer.  These infringement suits were consolidated.

Following a bench trial, the District Court determined that the '318 patent was invalid for lack of enablement.  The District Court based its determination on two grounds:  (1) the specification of the '318 patent did not demonstrate utility because relevant animal testing experiments were "not finished . . . by the time the '318 patent was allowed" and the specification provided only "minimal disclosure" of utility, and (2) the specification and claims did not "teach one of skill in the art how to use the claimed method" because the application "only surmise[d] how the claimed method could be used" without providing sufficient galanthamine dosage information.

Writing for the majority, Judge Dyk, joined by Judge Mayer, cites Process Control Corp. v. HydReclaim Corp., 190 F.3d 1350, 1358 (Fed. Cir. 1999), for the proposition that "a patent claim [that] fails to meet the utility requirement because it is not useful or operative, . . . also fails to meet the how-to-use aspect of the enablement requirement."  Judge Dyk observes that "[t]ypically, patent applications claiming new methods of treatment are supported by test results," adding that "[o]ur predecessor court held in Krimmel [292 F.2d 948, 954 (CCPA 1961)] that animal tests showing that a new nonobvious compound 'exhibits some useful pharmaceutical property' are sufficient to demonstrate utility" and that "under appropriate circumstances, . . . the first link in the screening chain, in vitro testing, may establish a practical utility for the [pharmaceutical] compound in question," citing Cross v. Iizuka, 753 F.2d 1040, 1051 (Fed. Cir. 1985).

In affirming the District Court's judgment of invalidity for lack of enablement, Judge Dyk states that:

In this case, however, neither in vitro test results nor animal test results involving the use of galantamine to treat Alzheimer's-like conditions were provided.  The results from the '318 patent's proposed animal tests of galantamine for treating symptoms of Alzheimer's disease were not available at the time of the application, and the district court properly held that they could not be used to establish enablement.

In addition, Judge Dyk notes that Janssen did not contend, either during prosecution or at trial, that the six scientific papers discussed in the specification of the '318 patent established utility.  Instead, Janssen argued on appeal that utility may be established by analytic reasoning.  In particular, Janssen argued that the specification "set[] forth the evidence from existing studies demonstrating galantamine's effects on central nicotinic as well as muscarinic receptors and connect[ed] it to a model for Alzheimer's therapy rendering those effects therapeutically relevant."  Judge Dyk, however, states that "[t]hese insights . . . are nowhere described in the specification."  He also states that "at the end of the day, the specification, even read in the light of the knowledge of those skilled in the art, does no more than state a hypothesis and propose testing to determine the accuracy of that hypothesis," which is "not sufficient."  Judge Dyk, therefore, concludes that "[t]he '318 patent's description of using galantamine to treat Alzheimer’s disease thus does not satisfy the enablement requirement because the '318 patent's application did not establish utility."

Writing in dissent, Judge Gajarsa contends that District Court's determination of non-enablement should have been vacated because the lower court "did not undertake the required legal analysis to determine whether an ordinarily skilled artisan reading the patent would understand it to reveal a credible utility for the invention," and further, "failed to make the factual findings necessary to support the ultimate legal conclusion regarding enablement."  Noting that "[t]he parties do not dispute that Dr. Davis's insight regarding galantamine's utility for treating Alzheimer's Disease (AD) was correct," Judge Gajarsa states that "[t]he relevant question here is whether, at the time Dr. Davis filed her application, the patent's written description would have credibly revealed to an ordinarily skilled artisan galantamine's utility for AD treatment."

With respect to the issues of obviousness and enablement, Judge Gajarsa argues that:

In terms of the present case, if Dr. Davis used her unique neuroendocrine perspective to examine the prior art and arrive at a novel insight about galantamine based on selected prior art findings, then the invention may be nonobvious; and if her patent disclosed those selected findings in such a manner that a person of ordinary skill would credit her insight regarding galantamine's utility, then the invention is enabled.

However, in the instant case:

[T]he district court committed error . . . by focusing generally on what the prior art does or does not teach -- the primary factual consideration underlying obviousness -- while neglecting to consider what the patent text discloses to an ordinarily skilled artisan -- the primary factual consideration underlying enablement.

In particular, Judge Gajarsa contends that the District Court failed to "determine how one of ordinary skill would understand [the findings of the six prior art studies described in the specification], either independently or in combination with one another."

Judge Gajarsa also finds fault with "the majority opinion's emphasis on the sufficiency of the evidence presented by Janssen."  Stating that "the majority fails to establish the defendants' burden and instead focuses almost exclusively on the sufficiency of Janssen's showing and the merit of Janssen's arguments," Judge Gajarsa argues that such focus is improper.  Moreover, "[b]ecause the district court erred as a matter of law and failed to make certain required factual findings," Judge Gajarsa contends that "we cannot defer to the district court's legal conclusion or fact-findings, and thus, it is particularly problematic for the majority to require Janssen to demonstrate on appeal that its patent is valid."

In re '318 Patent Infringement Litigation (Fed. Cir. 2009)
Panel: Circuit Judges Mayer, Gajarsa, and Dyk
Opinion by Circuit Judge Dyk; dissenting opinion by Circuit Judge Gajarsa

AstraZeneca Pharmaceuticals LP v. Teva Pharmaceuticals USA, Inc. (Fed. Cir. 2009)

Sometimes, Sins of Omission Are Not Inequitable Conduct

    By Kevin E. Noonan --

St. Thomas Aquinas recognized two types of sin:  those of omission and those of commission.  In patent law, inequitable conduct comes closest to this concept of sin, where frequently the accused behavior is the failure to submit to a patent examiner during prosecution information that is material to patentability.  However, mere failure to submit is not enough; there must be some evidence of deceptive intent.  Kingsdown Medical Consultants, Ltd. v. Hollister Inc., 863 F.2d 867 (Fed. Cir. 1988) (en banc).  These principles were reaffirmed last Friday by the Federal Circuit in AstraZeneca Pharmaceuticals LP v. Teva Pharmaceuticals USA, Inc.

AstraZeneca sued Teva and Sandoz pursuant to 35 U.S.C. § 271(e)(2)(A) for filing ANDAs for a generic version of Seroquel®, an antipsychotic agent.  Each ANDA contained a Paragraph IV certification that AstraZeneca's U.S. Patent No. 4,879,288 (the '288 patent), its Orange Book-listed patent for Seroquel®, was invalid and/or not infringed.  The patent claims quetiapine (the generic name for Seroquel®), an atypical antipsychotic having the chemical structure:

(An "atypical" antipsychotic agent is characterized by what it does not do:  it does not cause involuntary body movements such as "torsion spasms, muscle spasms . . . dystonia's of the face neck or back with protrusion of the tongue and tonic spasms of the limbs (dyskinesias).")  The District Court granted summary judgment that AstraZeneca was not guilty of inequitable conduct in obtaining the '288 patent.

The Federal Circuit agreed, in an opinion by Judge Newman, joined by Judges Rader and Prost.  The material information asserted by Teva and Sandoz to have been omitted by AstraZeneca concerned a number of quetiapine analogs, including the following:

AstraZeneca submitted several prior art references relating to these compounds, specifically a German-language publication (Compound 210786), U.S. Patent No. 3,389,139 to Schmutz ("Schmutz I"; Perlapine), U.S. Patent No. 3,539,573 to a second Schmutz reference ("Schmutz II"; Compound 24028), and U.S. Patent No. 4,308,207 to Hunzikerr (Fluperlapine).

The Examiner issued an obviousness rejection on chemical structural obviousness grounds over the Schmutz II compound in view of additional references, including U.S. Patent No. 4,097,597 to Horrom disclosing the Horrom Compound, and another species from the Schmutz II reference, termed Schmutz X by the parties.

AstraZeneca responded to the rejection with argument regarding the unpredictability of "the critical physiological property of atypicality," wherein the prior art did not provide a rationale for choosing the substitutions resulting in quetiapine.  These arguments proved unavailing, with the Examiner demanding that AstraZeneca "provide proof that the prior art compounds do not necessarily or inherently posses the characteristics of the claimed compounds."  Specifically, the Examiner required that AstraZeneca overcome his structural obviousness rejection "by a side-to-side comparison with the closest prior art compound(s)."  The Examiner required this evidence for the Horrom compound and the Schmutz X compound but none of the other compounds disclosed by AstraZeneca.

The patent applicant responded with a declaration by one of the inventors, Dr. Migler, with data for each of the asserted compounds.  In his declaration, Dr. Migler attested to the antipsychotic activity not of the Schmutz X compound but a related compound termed Schmutz B:

The reason for this substitution provided to the Examiner by AstraZeneca was that data for Schmutz X did not exist and "would be very expensive to generate right now."  The data Dr. Migler submitted with his declaration showed that the antipsychotic behavior of these compounds was "typical."  In addition, Dr. Miglar attested in his declaration that another compound, termed "Schmutz A," showed no antipsychotic behavior; this compound differed from the quetiapine compound in having a chlorine atom substitution in the left benzene ring of the heterocyclic structure and having a methyl group as a side chain.

Defendants argued at trial, and before the Federal Circuit, that what AstraZeneca did not disclose to the Patent Office was internal data showing atypical antipsychotic behavior for perlapine, fluperlapine, Compound 21076, and Compound 24028, and that withholding this data was "deliberately misleading."  The essence of Defendants' argument, according to Judge Newman's opinion, was that "AstraZeneca presented internal test data about similar compounds that were typical while omitting internal test data about similar compounds that were potentially atypical."  This argument did not convince the District Court, which ruled that AstraZeneca had disclosed the closest prior art and had addressed the arguments and provided the evidence required by the Examiner.

Judge Newman's opinion noted that there was no assertion that AstraZeneca withheld any "relevant" reference.  The art AstraZeneca did cite (the Hunzinger patent, for example) disclosed atypical antipsychotics including fluperlapine, and any internal data possessed by AstraZeneca was thus cumulative.  The Federal Circuit rejected the Defendants' allegations that AstraZeneca made material misrepresentations during prosecution (such as it being "too expensive" to provide data for the Schmutz X compound) as being without evidence, nor was there evidence that, had AstraZeneca made and tested the Schmutz X compound, material evidence would have been produced, said the Court.  The Court said that the unpredictability of whether a particular analog had atypical antipsychotic properties was "undisputed," and that "the record demonstrates that structural similarity is not a predictor of whether antipsychotic behavior would be typical or atypical."  The Court also assessed whether the compounds having data regarding antipsychotic behavior that AstraZeneca did not disclose were "equally close" in chemical structure to the compounds whose data was disclosed and to quetiapine.  In its analysis, the Court found that substitution of the Schmutz B compound data for Compound 24028 data was not a material representation, based on structural grounds (and despite evidence that their antipsychotic behavior differed in ways that did not support AstraZeneca's argument).  The Court's analysis rested on its assessment that AstraZeneca submitted data for the "structurally closest" compounds, and the compounds asserted by the Examiner.  The Court opined:

A reasonable examiner would not have understood the Migler declaration as stating that no prior art product had the atypical property shown by quitiapine, for it was known that other atypical antipsychotics existed . . . .  A reasonable examiner would understand AstraZeneca's statements to refer to the closest prior art compounds, not all prior art compounds.

Thus, according to the opinion, the evidence did not support a finding that AstraZeneca misrepresented or omitted material information, despite AstraZeneca's failure to disclose all its data for several of these prior art compounds.

Similarly, the Court found that the Defendants did not establish deceptive intent by clear and convincing evidence.  Defendants' argument suffered because it suggested that, due to the "high degree of materiality" it had shown regarding the withheld information, "they therefore need a proportionally lesser showing of intent to deceive to establish the requisite threshold level of intent."  The Court was succinct in its evaluation of this argument:  "[t]hat is incorrect," it said, and "[e]vidence of mistake or negligence, even gross negligence, is not sufficient to support inequitable conduct . . .," citing Kingsdown Medical.  A court must balance evidence of materiality and deceptive intent, said the Federal Circuit, but only after threshold levels of materiality and deceptive intent have been shown by clear and convincing evidence.  The Defendants' evidence of deceptive intent was merely the existence of the undisclosed data showing that some of the prior art compounds had atypical antipsychotic behavior and AstraZeneca's failure to expressly disclose this evidence to the Patent Office.  Intent to withhold, however, is not the same as intent to deceive, according to the Court, and "[i]ntent to deceive cannot be inferred simply from the decision to withhold [information] where the reasons given for withholding are plausible," citing Dayco Products Inc. v. Total Containment, Inc.  In the absence of any evidence of bad faith, the Court found AstraZeneca "presented plausible reasons for its presentation of arguments and data during the prosecution" which did not support a finding of deceptive intent.

Regardless of the soundness of the Federal Circuit's opinion, the case illustrates how difficult making an inequitable conduct determination can be.  Even in situations where no affirmative sins of commission appear to have been committed, omissions that are sinful can be devilishly difficult to discern, and their motivations even more so.

AstraZeneca Pharmaceuticals LP v. Teva Pharmaceuticals USA, Inc. (Fed. Cir. 2009)
Panel:  Circuit Judges Newman, Rader, and Prost
Opinion by Circuit Judge Newman

Obviousness-type Double Patenting after Amgen v. F. Hoffmann-La Roche

    By Kevin E. Noonan --

Although Amgen's erythropoietin franchise has weathered its most recent challenge by F. Hoffmann-La Roche's pegylated EPO analog, Mircera® (see Amgen Inc. v. F. Hoffman-La Roche Ltd. (Fed. Cir. 2009)), the victory was not absolute.  The status of three of the patents-in-suit -- U.S. Patent Nos. 5,547,933 (the '933 patent), 5,955,422 (the '422 patent, claim 1) and 5,756,349 (the '349 patent, claim 7) -- were put in jeopardy by the Federal Circuit's reversal of summary judgment and remand to the District Court on the question of whether these patents are invalid for obviousness-type double patenting.  If the District Court were to make a determination that they are invalid, Amgen's EPO patent estate will expire almost two years earlier than expected, with loss of at least a portion of the company's significant revenues from its flagship product.  The likelihood of this outcome will depend on the parties' reaction to the latest installment of Federal Circuit jurisprudence on obviousness-type double patenting following its decision last year in Pfizer, Inc. v. Teva Pharmaceuticals USA, Inc.

The ultimate parent application, which matured into U.S. Patent No. 4,703,008, was subject to a restriction requirement identifying the following groups of claims:

I.  Claims 1–13, 16, 39–41, 47–54, and 59, drawn to polypeptide, classified in Class 260, subclass 112.
II.  Claims 14, 15, 17–36, 58, and 61–72, drawn to DNA, classified in Class 536, subclass 27.
III.  Claims 37–38, drawn to plasmid, classified in Class 435, subclass 317.
IV.  Claims 42–46, drawn to cells, classified in Class 435, subclass 240.
V.  Claims 55–57, drawn to pharmaceutical composition, classified in Class 435, subclass 177.
VI.  Claim 60, drawn to assay, classified in Class 435, subclass 6.

Pursuant to the restriction requirement, each of these claim groupings defined an independently-patentable invention, and as such would entitle Amgen to a separate patent unfettered by obviousness-type double patenting.  It is undisputed that Amgen prosecuted the claims of Group II in the '008 patent.  Thereafter, Amgen filed two applications claiming priority to the '008 patent, the '178 application and the '179 application; these applications are related to the patents-in-suit according to the following schematic diagram:

The Court characterized "in broad strokes" the claims of the three patents under consideration:

[T]he '933 patent claims recombinant EPO, a pharmaceutical composition comprising recombinant EPO, and methods of treating kidney dialysis patients by administering pharmaceutical compositions comprising recombinant EPO . . . .  The '422 patent claims a pharmaceutical composition comprising recombinant EPO . . . .  The '349 patent claims the process of producing recombinant EPO in vertebrate cells capable of producing EPO at a specific rate.

At first blush, the claims of the '933 patent would appear to correspond to Groups I and V from the '008 restriction requirement, and the claims of the '422 patent correspond to Group V.  Two other patents-in-suit -- U.S. Patent Nos. 5,441,868 (the '868 patent) and 5,618,698 (the '698 patent) -- recite claims for methods of making EPO.

Roche's position, unpersuasive at the District Court, was that the claims of the '933, '422, and '394 patents were invalid for obviousness-type double patenting over the claims of the '868 and '698 patents, and in turn the claims of the '868 and '698 patents were invalid for obviousness-type double patenting over the claims of the '008 patent.  This question depends on the meaning of 35 U.S.C. § 121, which sets forth a "safe harbor" provision protecting claims subject to a restriction requirement (and thus determined by the Patent Office to define separately-patentable inventions) from a determination of obviousness-type double patenting:

A patent issuing on an application with respect to which a requirement for restriction under this section has been made, or on an application filed as a result of such a requirement, shall not be used as a reference either in the Patent and Trademark Office or in the courts against a divisional application or against the original application or any patent issued on either of them, if the divisional application is filed before the issuance of the patent on the other application.

35 U.S.C. § 121, third sentence; see also Applied Materials, Inc. v. Advanced Semiconductor Materials Am., Inc., 98 F.3d 1563 (Fed. Cir. 1996), cited in the Court's opinion.  The District Court held that the '933, '422, and '349 patents were immunized from obviousness-type double patenting, since they had issued from applications in the chain back to the '178 and '179 applications, which were filed pursuant to a Patent Office-imposed restriction requirement.  However, these applications when filed were not designated as "divisional applications," the language of the statute, but rather as "continuation applications," and Roche argued that this difference precluded the '933, '422, and '349 patents from the § 121 safe harbor.

The Federal Circuit agreed, to the extent that summary judgment and JMOL granted by the District Court was improper.  In its opinion, by Judge Schall and joined by Judges Mayer and Clevenger, the CAFC granted no deference to the District Court's decision, first applying its own standard of review regarding summary judgment, next using the 1st Circuit's standard of review for JMOL, and last for the substantive question of obviousness-type double patenting, which it interpreted as being analogous to claim construction, as a "matter of what is claimed" and thus subject to the Federal Circuit's de novo review precedent.  Using these standards, the Federal Circuit held that the '933, '422, and '349 patents were not entitled to the § 121 safe harbor because the '178 and '179 applications were filed as continuation applications and not divisional applications.  In interpreting the statute so literally, the CAFC noted that, unlike the claims in the Pfizer case that arose from a continuation-in-part application, each of the '933, '422, and '349 patents may have satisfied the substantive requirements for divisional application status -- being limited to the subject matter disclosed in the prior parent application, reciting claims determined to define a patentably-distinct invention, and being filed during the pendency of the earlier-filed parent application.  Nonetheless, the Court held that "[t]his distinction . . . does not justify departing from a strict application of the plain language of §121, which affords its [safe harbor] benefits to 'divisional applications.'"  In making this decision, the CAFC distinguished both its Applied Materials and Symbol Technologies, Inc. v. Opticon, Inc., 935 F.2d 1569 (Fed. Cir. 1991) precedent, because in those cases the "continuation" application was filed ultimately from a properly-designated divisional application.

The CAFC reached a different conclusion with regard to the '868 and '698 patents, because the parties litigated the obviousness-type double patenting question on the merits before the District Court.  As characterized in the Federal Circuit's opinion, the claims of the '008 patent recite a recombinant cell that expresses human EPO, and the claims of the '868 and '698 patents recite methods of producing recombinant EPO using such cells, either in vitro or in vivo.  The District Court distinguished the method claims of the '868 and '698 patents and the recombinant cell (product or composition) claims of the '008 patent because:

none of the '008 claims require:  (1) that the recited host cell actually express any EPO polypeptide; (2) that the recited host cell actually express a glycosylated EPO polypeptide; (3) that the host cell be capable of producing an isolatable amount of a glycosylated EPO polypeptide; and (4) that any glycosylated EPO isolated from cells grown in culture have the stated in vivo function.

The District Court relied on expert testimony for the proposition that, even if in possession of the recombinant cell disclosed in the '008 patent, at the priority date claims to methods for making EPO were novel, useful, and non-obvious.  (The lower court also noted that the Patent Office had found these claims to be patentably-distinct.)  The Federal Circuit agreed with this distinction, that while the recombinant cells claimed in the '008 patent might be "capable of producing" recombinant EPO having in vivo biological function, the claim did not recite a limitation that such cells actually produce functional EPO.  This requirement is affirmatively found in the '868 and '698 patent claims, rendering them patentably distinct.

In making this determination, the Federal Circuit invoked a number of recent, post-KSR decisions on obviousness under 35 U.S.C. § 103, the standard used without using the '008 patent as prior art, including In re Kubin, In re O'Farrell (where the application, not the case, is recent), and Pharmastem Therapeutics, Inc. v. Viacell Inc.  The CAFC opined that the skilled artisan would not have reasonably expected to produce recombinant, glycosylated EPO having the properties -- biological activity, post-translational modifications and amount -- required by the claims of the '868 and '698 patents at the time of the invention.  In making this determination, the Federal Circuit rejected Roche's argument that the capacity for making recombinant EPO was inherent in the claimed cells (and did not address the issue of whether the claims of the expired '008 patent would have satisfied the utility or enablement requirements if the claimed cells did not inherently produce functional recombinant EPO).  The CAFC applied the Supreme Court's KSR warning against hindsight in refusing to consider the actuality that the cells claimed in the '008 patent produced biologically-active EPO in determining whether the skilled worker would have had an expectation that they would do so.

Finally, the Federal Circuit clarified the application of the principles it enunciated in Takeda Pharmaceutical Co. v.  Doll regarding the availability of later-disclosed (or discovered) methods to overcome obviousness-type double patenting invalidation of a process claim over an earlier-issued product claim.  In Takeda, the Federal Circuit held that art used by a patentee to support patentable distinctiveness of process claims filed after grant of product claims was limited to art-recognized processes known at the time the later (or "secondary" in the Takeda court's parlance) patent application was filed.  Roche argued that Amgen should not be permitted to introduce evidence relating to processes for producing recombinant EPO after the 1984 filing date of the '008 patent where Roche was precluded from asserting art available after the 1984 priority date.

Here, the Federal Circuit held that Roche's arguments "collide" with 35 U.S.C. § 120, wherein Amgen's later-filed applications are entitled to the benefit of priority to the '008 patent.  The CAFC found that interpreting its Takeda precedent as Roche advocated would "violate the plain language" of § 120, which entitles all of Amgen's patents-in-suit to the priority benefit of the '008 patent and accordingly prevents any of Amgen's patents-in-suit from being invalidated based on art available after the November 30, 1984 priority date of the '008 patent.  The Court's opinion acknowledged (and asserted that the Takeda court recognized) that this rule "could 'provide the patentee with the best of both worlds:  the applicant can use the filing date as a shield, enjoying the earlier priority date in order to avoid prior art, and rely on later-developed alternative processes as a sword to defeat double patenting challenges.'"  Nonetheless, the Federal Circuit characterized this seeming one-sidedness as being limited and hence not inequitable.  However, the CAFC noted that the '349 patent could not benefit from the application of the principles in the Takeda opinion, since it (unlike the '933 and '422 patents) recited claims to methods and not products.  Thus:

Takeda will permit Amgen, if it wishes to do so, to rely on alternative processes for making the products claimed in the '933 and '422 patents up to their filing dates to prove that the claims of those patents and the claims of the '868 and '698 patents are patentably distinct.  If Amgen pursues that course, Roche will be free to rely on subsequent developments in the art up to the filing dates of the '933 and '422 patents to prove that any alternative processes put forth by Amgen do not render the claims of the '933 and '422 patents and the claims of the '868 and '698 patents patentably distinct.

Unless the parties settle, on remand it can be expected that the District Court will be compelled to find the asserted claims of the '933, '422, and '349 patents invalid for obviousness-type double patenting, unless Amgen can establish patentable distinctiveness on the merits (i.e., outside the § 121 safe harbor).  Until such time (including any further appeals to the Federal Circuit or the Supreme Court), the significant holding in this decision is that whether a claim is entitled to the § 121 safe harbor depends, in the first instance, on whether the application reciting that claim is designated as a "divisional" and not a "continuation" application.  (Such claims must also satisfy the requirements for divisional applications.)  The Federal Circuit's opinion is stringent, harsh, and unyielding, and provides another "trap for the unwary" for which patent law is infamous.  It also raises the specter of malpractice liability in designating follow-on applications accurately, a practice tip that the patent bar ignores at its peril.

Court Report

    By Sherri Oslick --

About Court Report:  Each week we will report briefly on recently filed biotech and pharma cases, and a few interesting cases will be selected for periodic monitoring.

Eurand Inc. et al. v. Anchen Pharmaceuticals Inc. et al.
1:09-cv-00715; filed September 23, 2009 in the District Court of Delaware

• Plaintiffs:  Eurand Inc.; Anesta AG
• Defendants:  Anchen Pharmaceuticals Inc.; Anchen Inc.

Infringement of U.S. Patent Nos. 7,387,793 ("Modified Release Dosage Forms of Skeletal Muscle Relaxants," issued July 17, 2008) and 7,544,372 (same title, issued June 9, 2009), licensed to Cephalon, following a Paragraph IV certification as part of Anchen's filing of an ANDA to manufacture a generic version of Cephalon's Amrix® (cyclobenzaprine hydrochloride, used for relief of muscle spasm associated with acute, painful musculoskeletal conditions).  View the complaint here.

Astellas Pharma Inc. et al. v. Teva Pharmaceuticals USA, Inc. et al.
1:09-cv-08100; filed September 22, 2009 in the District Court of New Jersey

• Plaintiffs:  Astellas Pharma Inc.; Astellas Pharma US, Inc.
• Defendants:  Teva Pharmaceuticals USA, Inc.; Teva Pharmaceuticals Industries, Ltd.

Infringement of U.S. Patent No. 6,017,927 ("Quinuclidine Derivatives and Medicinal Composition Thereof," issued January 25, 2000), following a Paragraph IV certification as part of Teva's filing of an ANDA to manufacture a generic version of Astellas' VESIcare® (solifenacin succinate, used to treat overactive bladder with symptoms of urge urinary incontinence, urgency, and urinary frequency).  View the complaint here.

Life Technologies Corp. et al. v. Illumina Inc. et al.
1:09-cv-00706; filed September 21, 2009 in the District Court of Delaware

• Plaintiffs:  Life Technologies Corp.; Applied Biosystems LLC; Institute for Protein Research; Alexander Chetverin; Helena Chetverina; William Hone
• Defendants:  Illumina Inc.; Solexa Inc.

Infringement of U.S. Patent Nos. 5,616,478 ("Method for Amplification of Nucleic Acids in Solid Media," issued April 1, 1997), 5,958,698 ("Method for Amplification and Expression of Nucleic Acids in Solid Media and its Application for Nucleic Acid Cloning and Diagnostics," issued September 28, 1999), and 6,001,568 ("Solid Medium for Amplification and Expression of Nucleic Acids as Colonies," issued December 14, 1999) based on Defendants' manufacture and sale of its DNA sequencing products and services, including Defendants' Genome Analyzer and Genome Analyzer II.  View the compliant here.

Research Foundation of State University of New York et al. v. Impax Laboratories Inc.
1:09-cv-00703; filed September 18, 2009 in the District Court of Delaware

• Plaintiffs:  Research Foundation of State University of New York; New York University; Galderma Laboratories Inc.; Galderma Laboratories LP
• Defendant:  Impax Laboratories Inc.

Infringement of U.S. Patent Nos. 7,232,572 ("Methods of Treating Rosacea," issued June 19, 2007), 7,211,267 ("Methods of Treating Acne" issued May 1, 2007), 5,789,395 ("Method of Using Tetracycline Compounds for Inhibition of Endogenous Nitric Oxide Production" issued Augst 4, 1998), and 5,919,775 ("Method for Inhibiting Expression of Inducible Nitric Oxide Synthase with Tetracycline," issued April 16, 1998), all either assigned or licensed to Galderma, following a Paragraph IV certification as part of Mylan's filing of an ANDA to manufacture a generic version of Galderma's Oracea® (doxycyline delayed release capsules, used to treat inflammatory lesions of rosacea).  View the complaint here.

Life Technologies Corp. et al. v. Biosearch Technologies, Inc.
2:09-cv-00283; filed September 18, 2009 in the Eastern District of Texas

• Plaintiffs:  Life Technologies Corp.; Applied Biosystems, LLC
• Defendant:  Biosearch Technologies, Inc.

Infringement of U.S. Patent Nos. 5,538,848 ("Method for Detecting Nucleic Acid Amplification Using Self-Quenching Fluorescence Probe," issued July 23, 1996), 5,723,591 ("Self-Quenching Fluorescence Probe," issued March 3, 1998), 5,876,930 ("Hybridization Assay Using Self-Quenching Fluorescence Probe," issued March 2, 1999), 6,030,787 (same title, issued February 29, 2000), and 6,258,569 (same title, issued July 10, 2001) based on Biosearch's manufacture and sale of dual-labeled probes incorporating a quencher and fluorophore reporter covalently linked to the 3' or 5' ends of an oligonucleotide that are used to monitor DNA amplification in real-time.  View the complaint here.

Bayer Schering Pharma AG et al. v. Teva Pharmaceuticals USA Inc. et al.
1:09-cv-00682; filed September 15, 2009 in the District Court of Delaware

• Plaintiffs:  Bayer Schering Pharma AG; Bayer HealthCare Pharmaceuticals Inc.; Schering Corp.
• Defendants:  Teva Pharmaceuticals USA Inc.; Teva Pharmaceutical Industries Ltd.

Infringement of U.S. Patent No. 6,362,178 ("2-phenyl Substituted Imidazotriazinones as Phosphodiesterase Inhibitors," issued March 26, 2002) following a Paragraph IV certification as part of Teva's filing of an ANDA to manufacture a generic version of plaintiffs' Levitra® (vardenafil hydrochloride, used to treat erectile dysfunction).  View the complaint here.

Boehringer Ingelheim Pharma GmbH & CO. KG et al. v. Kappos
1:09-cv-01729; filed September 11, 2009 in the District Court of the District of Columbia

• Plaintiffs:  Boehringer Ingelheim Pharma GmbH & Co. KG; Boehringer Ingelheim International GmbH; Boehringer Ingelheim Pharmaceuticals, Inc.
• Defendant:  David Kappos

Review and correction of the patent term adjustment calculation made by the U.S. Patent and Trademark Office for U.S. Patent No. 7,504,378 ("Macrocyclic Peptides Active Against the Hepatitis C Virus," issued March 17, 2009).  View the complaint here.

Warner Chilcott Co., LLC v. Lupin Ltd. et al.
1:09-cv-02394; filed September 11, 2009 in the District Court of Maryland

• Plaintiff:  Warner Chilcott Co., LLC
• Defendants:  Lupin Ltd.; Lupin Pharmaceuticals, Inc.

Infringement of U.S. Patent No. 5,552,394 ("Low Dose Oral Contraceptives with Less Breakthrough Bleeding and Sustained Efficacy," issued September 3, 1996) following a Paragraph IV certification as part of Lupin's filing of an ANDA to manufacture a generic version of Warner Chilcott's Loestrin® 24 Fe (norethindrone acetate and ethinyl estradiol tablets, and ferrous fumarate tablets, used for oral contraception).  View the complaint here.

Warner Chilcott Co., LLC v. Lupin Ltd. et al.
1:09-cv-02399; filed September 11, 2009 in the District Court of Maryland

• Plaintiff:  Warner Chilcott Co., LLC
• Defendants:  Lupin Ltd.; Lupin Pharmaceuticals, Inc.

Infringement of U.S. Patent No. 6,667,050 ("Chewable Oral Contraceptive," issued December 23, 2003) following a Paragraph IV certification as part of Lupin's filing of an ANDA to manufacture a generic version of Warner Chilcott's Femcon Fe® (formerly Ovcon® 35 Fe, norethindrone and ethinyl estradiol tablets, and ferrous fumarate tablets, used for oral contraception).  View the complaint here.

Astellas US LLC et al. v. Wockhardt Ltd. et al.
2:09-cv-04654; filed September 10, 2009 in the District Court of New Jersey

• Plaintiffs:  Astellas US LLC; Astellas Pharma US, INC.; Item Development AB
• Defendants:  Wockhardt Ltd.; Wockhardt USA, Inc.

Infringement of U.S. Patent No. 5,731,296 ("Selective Vasodilation by Continuous Adenosine Infusion," issued March 24, 1998), licensed to Astellas, following a Paragraph IV certification as part of Wockhardt's filing of an ANDA to manufacture a generic version of Astellas' Adenoscan® product (adenosine injection, used as a diagnostic for myocardial reperfusion injury).  View the complaint here.

Albany Molecular Research, Inc. v. Sandoz, Inc. et al.
2:09-cv-04639; filed September 9, 2009 in the District Court of New Jersey

• Plaintiff:  Albany Molecular Research, Inc.
• Defendants:  Sandoz, Inc.; Dr. Reddy's Laboratories, Ltd.

Infringement of U.S. Patent No. 7,390,906 ("Piperidine Derivatives and Process for Their Production," issued June 24, 2008) based on Defendants' intended commercial manufacture of fexofenadine hydrochloride, the active ingredient in Aventis' Allegra® and Allegra-D® (used to treat allergies).  View the complaint here.

Albany Molecular Research, Inc. v. Dr. Reddy's Laboratories, Ltd. et al.
2:09-cv-04638; filed September 9, 2009 in the District Court of New Jersey

• Plaintiff:  Albany Molecular Research, Inc.
• Defendants:  Dr. Reddy's Laboratories, Ltd.; Dr. Reddy's Laboratories, Inc.

Infringement of U.S. Patent No. 7,390,906 ("Piperidine Derivatives and Process for Their Production," issued June 24, 2008) based on Reddy's current and intended commercial manufacture and sale of products containing fexofenadine hydrochloride, the active ingredient in Aventis' Allegra® and Allegra-D® (used to treat allergies).  View the complaint here.

Conference & CLE Calendar

September 30-October 1, 2009 - Biotech Patents*** (American Conference Institute) - Boston, MA

October 5-6, 2009 - Patent Litigation 2009 (Practising Law Institute) - McLean, VA

October 7-8, 2009 - Maximizing Pharmaceutical Patent Lifecycles*** (American Conference Institute) - New York, NY

October 14, 2009 - Developments in Pharmaceutical and Biotech Patent Law (Practising Law Institute) - San Francisco, CA

October 15-16, 2009 - Patent Litigation 2009 (Practising Law Institute) - Chicago, IL

October 20-21, 2009 - 17th Forum on Biotech Patenting (C5) - London, United Kingdom

October 22-23, 2009 - Pharmaceutical Congress on Paragraph IV Disputes*** (Center for Business Intelligence) - Philadelphia, PA

October 26-28, 2009 - Intellectual Property Counsels' Committee (IPCC) Fall Conference & Meeting (Biotechnology Industry Organization) - Washington, DC

November 9-10, 2009 - Patent Litigation 2009 (Practising Law Institute) - Atlanta, GA

November 9-11, 2009 - Developing IP Strategies for Crystalline Forms*** (International Quality & Productivity Center) - London, England

November 10, 2009 - The Patent Cooperation Treaty (PCT): Important Tool for Small and Medium-Sized Enterprises (SMEs) and Independent Inventors (World Intellectual Property Organization) - Baltimore, MD

November 12-13, 2009 - Paragraph IV on Trial*** (American Conference Institute) - New York, NY

November 13, 2009 - The Patent Cooperation Treaty (PCT): Important Tool for Small and Medium-Sized Enterprises (SMEs) and Independent Inventors (World Intellectual Property Organization) - Las Vegas, NV

November 16-17, 2009 - Patent Litigation 2009 (Practising Law Institute) - New York, NY

November 17-18, 2009 - Structuring, Negotiating, and Managing Pharma/Biotech Collaborative Agreements (American Conference Institute) - New York, NY

December 7-8, 2009 - Foreign Patent Law & Regulation*** (American Conference Institute) - New York, NY

***Patent Docs is a media partner of this conference or CLE

USPTO and ARIPO Sign Bilateral Cooperation Agreement

    By Donald Zuhn --

The U.S. Patent and Trademark Office announced today that it had signed a Workplan for Bilateral Cooperation on intellectual property issues with the African Regional Intellectual Property Organization (ARIPO).  The Workplan, which will serve to promote the development of effective intellectual property systems in ARIPO member countries, was signed by Under Secretary of Commerce for Intellectual Property David Kappos and Director General of ARIPO Dr. Gift Huggins Sibanda on Thursday in Geneva.  ARIPO is an intergovernmental organization consisting of 16 African countries that operates as a central intellectual property filing system.  The USPTO press release noted that the Workplan would strengthen the bilateral relationship between ARIPO and USPTO and increase public awareness about the importance of intellectual property issues.  Under the Workplan, the USPTO will also train ARIPO patent and trademark examiners to further develop their technical expertise and capacity to respond to increasing workloads.

USPTO Seeks Comments Regarding Sequence Listing Rules - Updated

    By Donald Zuhn --

The U.S. Patent and Trademark Office recently published a notice in the Federal Register inviting public comment regarding the Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence Disclosures (74 Fed. Reg. 40163).  David Boundy, the Vice President of Intellectual Property for Cantor Fitzgerald L.P. and one of the architects of the campaigns against the USPTO's claims and continuations, IDS, Markush, and appeals rules packages, brought the six-week-old notice to our attention.  Earlier today, we had an opportunity to discuss the sequence listing notice with Mr. Boundy, Dr. Richard Belzer (a former civil service staff economist in the Office of Information and Regulatory Affairs within the OMB and another architect of the aforementioned campaigns), and Stephen Albainy-Jenei (author of the Patent Barristas weblog).  While Mr. Boundy and Dr. Belzer agreed that the sequence listing notice was fairly noncontroversial, they wanted to remind patent practitioners about the importance of providing comments, if for no other reason then to let the Patent Office know that the patent community was paying attention.

As for the notice itself, it briefly describes the ways in which a sequence listing may be submitted to the USPTO (i.e., in paper form, on electronic media, or via the EFS-Web) and the types of statements that may be required depending on the form of the submission.  In the notice, the Office also proposes adding a new sequence listing-related form -- a Request for Transfer of a Computer Readable Form Under 37 CFR 1.821(e) (PTO/SB/93) -- to be used when the computer-readable form (CRF) of an application's sequence listing is identical to the CRF of a sequence listing submitted in another application.

The part of the notice most likely to trigger comment concerns the USPTO's paperwork burden calculations.  The notice estimates that it will take the public approximately 6 to 80 minutes to gather the necessary information, prepare the Request for Transfer form or a sequence listing, and submit either to the USPTO (see second table below).  Dr. Belzer and Mr. Boundy note that by law, these estimates are required to be objectively supported (i.e., not based on guesswork or the opinion of agency staff), and they must include everything in the expansive list given at 5 C.F.R. § 1320.3(b)(1):

(b)(1)  Burden means the total time, effort, or financial resources expended by persons to generate, maintain, retain, or disclose or provide information to or for a Federal agency, including:
    (i)  Reviewing instructions;
    (ii)[-(iv)]  Developing, acquiring, installing, and utilizing technology and systems for the purpose of collecting, validating, verifying [, processing, maintaining, disclosing and providing] information;
    (v)   Adjusting the existing ways to comply with any previously applicable instructions and requirements;
    (vi)  Training personnel to be able to respond to a collection of information;
    (vii)  Searching data sources;
    (viii)  Completing and reviewing the collection of information; and
    (ix)  Transmitting, or otherwise disclosing the information.

less the time that would be expended on managing the information in the usual and customary course of business.

Mr. Boundy has also provided us with the table of estimates that the USPTO gave in 2006:

which can be compared with the USPTO's current estimates (he notes that the time required to request and assemble the information, format it, burn it onto a CD, and retain all records for the life of the application and patent has dropped from one hour to 15 minutes):

Members of the public wishing to comment on the accuracy of the agency's estimate of the burden (including hours and cost) of the proposed collection of information are encouraged to do so.  The notice also invites comment regarding whether the proposed collection of information is necessary for the proper performance of the functions of the agency; ways to enhance the quality, utility, and clarity of the information to be collected; and ways to minimize the burden of the collection of information on respondents.  Written comments can be submitted by e-mail to Susan.Fawcett@uspto.gov (include A0651-0024 comment@ in the subject line of the message), by facsimile to 571-273-0112 (marked to the attention of Susan K. Fawcett), by mail to Susan K. Fawcett, Records Officer, Office of the Chief Information Officer, Administrative Management Group, United States Patent and Trademark Office, P.O. Box 1450, Alexandria, VA 22313-1450, or using the Federal Rulemaking Portal at www.regulations.gov, Docket ID: PTO-P-2009-0035 (link).  All comments must be submitted on or before October 13, 2009.

Mr. Boundy predicted that patent practitioners could expect to see more of these types of notices as the Patent Office begins to revise many of its old rulemaking habits -- habits that helped lead to the demise of the claims and continuations, IDS, Markush, and appeals rules packages.  Dr. Belzer noted that the USPTO must comply with these Paperwork Reduction Act procedures in order to obtain a valid OMB Control Number, and that without that number, it could not compel anyone to provide the demanded information.  He also noted that the USPTO had historically complied as minimally as possible with these statutory requirements, and in some cases had not complied at all.  In Dr. Belzer's opinion, this was made possible by the fact that few members of the public understand the Paperwork Reduction Act and fewer still are willing to engage in the public comment process.  It is Mr. Boundy's and Dr. Belzer's hope that the events of the past two years have changed the patent community's willingness to engage in a constructive and timely manner.  They also stressed that the new USPTO administration appears to be very interested in working with members of the patent community to improve all aspects of the examination process. Thus, participating now is the best way to ensure that the patent community's interests and concerns are known and understood as early in the process as possible, thereby making serious controversies unlikely in the future.

Patent Docs thanks Mr. Boundy and Dr. Belzer for their helpful comments and suggestions regarding today's article.

Biotech/Pharma Docket

    By Suresh Pillai --

Cook and W. L. Gore Prevail in Suit over Endovascular Grafts

The Court of Appeals for the Federal Circuit has affirmed a lower court ruling that neither Cook Inc. nor W. L. Gore & Associates infringed Edwards Lifesciences LLC's patents covering endovascular grafts used to treat aneurysms without open vessel surgery.  Both Edwards and EndoGAD Research Pty Ltd. filed suit for infringement in August 2003, alleging that products made by Cook and W. L. Gore infringed U.S. Patent Nos. 6,582,458, 6,613,073, 6,685,736, and 6,689,158.  The patents-in-suit are all related to the treatment of blood vessel occlusions via non-invasive balloon catheters.  In 2007, the U.S. District Court for the Northern District of California dismissed the case on summary judgment, having determined following its claim construction that the accused devices did not infringe the plaintiffs' patents.

The Federal Circuit affirmed the lower court decision, concluding that the lower court had correctly interpreted the claims.  The Federal Circuit also rejected Edwards' argument that, even under the lower court's claim construction, Edwards had presented evidence of infringement sufficient to survive summary judgment.  The patents-in-suit have already been the subject of one previous lawsuit.  In January 2006, Medtronic settled its infringement suit with Edwards for $37 million.  Medtronic also entered into a non-exclusive licensing agreement with Edwards for the manufacturing of devices covered by the patents-in-suit.

Life Technologies Files Suit against Biosearch over Flourescent Probe Patents

Life Technologies Corp. has filed suit against Biosearch Technologies, Inc., alleging that Biosearch infringed Life Technologies' patented technology covering production of self-quenching fluorescent probes.  The five patents-in-suit, U.S. Patent Nos. 5,538,848, 5,723,591, 5,876,930, 6,030,787, and 6,258,569, all cover technology related to the design of probes for real time monitoring of DNA amplification in PCR reactions.  In its filing, Life Technologies has asked for a declaratory judgment infringment and an injunction that would enjoin Biosearch from continuing to create probes encompassed by the patents-in-suit.  Should the court find that Biosearch willfully infringed upon the patents-in-suit, Life Technologies has asked that damages be trebled.  The technology that is covered by the patents can be practiced in any instrument platform capable of executing real-time PCR reactions.  Should the District Court find the patents valid and infringed, such a judgment would likely clear the way for Life Technologies to pursue licensing agreements for the technologies with all manufacturers of real-time PCR platforms as well as all synthesizers of real-time fluorophore/quencher probes.

Teva Files Appeal in Singulair® Infringement Suit

Last week, Teva Pharmaceuticals Industries, Inc. filed notice in the U.S. District Court for the District of New Jersey stating its intent to appeal the District Court's order barring Teva from marketing and manufacturing a generic version of Singulair®, a product made by Merck Sharpe & Dohme Pharmaceuticals SRL for the treatment of asthma.  Merck filed suit against Teva in April 2007, alleging that Teva had infringed Merck's patents covering Singulair® by filing an Abbreviated New Drug Application (ANDA) with the FDA in which Teva sought approval to make and market a generic version of Singulair® (see "Court Report," April 15, 2007).  In its complaint, Merck sought injunctive relief that would prevent Teva from marketing the generic until after the patent-in-suit's 2012 expiration date, a judgment of infringement, and attorneys' fees.  Merck followed up this filing with two more complaints, alleging the same claims and seeking the same relief, after Teva filed an ANDA with the FDA seeking permission to market different generic formulations of the drug.  In all three complaints, Merck alleges that Teva's FDA filings infringed Merck's U.S. Patent No. 5,565,473.

On August 19, 2009, the District Court ruled in Merck's favor, determining that Teva's proposed generic version of Singulair® would infringe Merck's '473 patent.  The Court enjoined Teva from manufacturing its generic version of Singulair®, and ordered the FDA not to grant approval for the proposed drug until the 2012 expiration of the '473 patent.

AstraZeneca Files Motion for Summary Judgment in Crestor® Case

With the case scheduled to go to trial in February, AstraZeneca recently filed a motion for summary judgment seeking a determination in its favor and against eight defendant generics manufacturers whom AstraZeneca has accused of infringing its patents covering the cholesterol drug Crestor®.  The first suit in this consolidated litigation was filed in December 2007 (see "Court Report," December 16, 2007) in the U.S. District Court for the District of Delaware.  In all of the suits, AstraZeneca alleged that the defendants' filings of Abbreviated New Drug Applications seeking to market and manufacture generic versions of its blockbuster drug infringed U.S. Reissue Pat. No. RE37,314, the patent covering Crestor®.  The defendants in the suit are Apotex Inc., Sandoz, Inc., Mylan Pharmaceuticals Inc., Sun Pharmaceutical Industries Ltd., Par Pharmaceutical Inc., Aurobindo Pharma Ltd., Teva Pharmaceuticals USA, and Cobalt Pharmaceuticals Inc.

USPTO and EPO Announce Extension of Trial Period for PPH Program

    By Christopher P. Singer --

In a notice dated September 23, 2009, the U.S. Patent and Trademark Office announced that it will extend for one year the trial period for its patent prosecution highway (PPH) program with the European Patent Office.  The extended trial period will expire on September 30, 2010.  As we have noted, the PPH programs are designed to expedite and leverage the examination process for applicants that have received favorable examination in one of the partner countries.

We reported last winter about the types of applications that are eligible for participation in the trial PPH, and the requirements for participation (see "Additional Application Types Eligible for Participation in PPH Between USPTO and EPO").  Updated requirements for participation in the USPTO will be available here, and requirements in the EPO will be posted here.

For additional information regarding this and other related topics, please see:

• "USPTO Initiates Patent Prosecution Highway Pilot Program with Finland Patent Office," June 29, 2009
• "USPTO Extends Patent Prosecution Highway Pilot Program with IP Australia; Begins Pilot Program with German Patent Office," April 15, 2009
• "USPTO Begins Pilot Program with the German Patent Office," May 7, 2009
• "Pilot PPH Program between Singapore and U.S.," February 1, 2009
• "Full Time Patent Prosecution Highway between Korea and US," January 28, 2009
• "Patent Prosecution Highway Pilot with CIPO Is Extended," December 23, 2008
• "Additional Application Types Eligible for Participation in PPH between USPTO and WPO," December 11, 2008
• "Patent Prosecution Highway Pilot Program between U.S. and Danish Patent Offices," October 29, 2008
• "Patent Prosecution Highway Expands to Europe," September 25, 2008
• "USPTO and UKIPO Extend Patent Prosecution Highway Pilot Program," September 3, 2008
• "USPTO and EPO to Implement Pilot Patent Prosecution Highway Program," April 29, 2008
• "Patent Prosecution Highway Extended to IP Australia," April 2, 2008
• "Patent Prosecution Highway Network Expands to Canada & Korea," January 29, 2008
• "USPTO Announces Two Additional Partners in the Patent Prosecution Highway Pilot Program," January 17, 2008
• "USPTO and JPO to Implement Patent Prosecution Highway on Full-Time Basis," December 27, 2007
• "USPTO and UK IPO to Collaborate on Patent Prosecution Highway," September 14, 2007

AsymmetRx, Inc. v. Biocare Medical, LLC (Fed. Cir. 2009)

    By Donald Zuhn --

Last week, the Federal Circuit determined that Plaintiff-Appellant AsymmetRx, Inc. did not have standing to bring an action for infringement of the patents-at-suit absent the participation of the President and Fellows of Harvard College.  As a result, the CAFC vacated and remanded an order by the District Court for the District of Massachusetts granting summary judgment in favor of Defendant-Appellee Biocare Medical, LLC.

Harvard owns U.S. Patent Nos. 6,946,256 and 7,030,227, which relate to anti-p63 monoclonal antibodies and methods for using them to detect malignant carcinoma.  In 2002, Harvard entered into a license agreement with Biocare to make, use, and sell p63 antibodies.  The Biocare license states that it "does not include a license under any U.S. or foreign patents" -- the '256 and '227 patents were pending but had not issued at the time Harvard entered into the agreement with Biocare.

In 2004, Harvard entered into a license agreement with AsymmetRx that also concerned p63 antibodies.  The AsymmetRx license states that AsymmetRx receives "an exclusive commercial license" for the '256 and '227 patents.  Under the terms of the AsymmetRx license, Harvard could (a) make and use the claimed p63 antibodies for academic research purposes, (b) grant non-exclusive licenses for the claimed p63 antibodies to other non-profit or governmental institutions for academic research purposes, (c) render the license non-exclusive if AsymmetRx failed to meet certain commercial use or public availability benchmarks or FDA filing milestones, and (d) suggest sub-licensees to AsymmetRx (Harvard would also receive a portion of all sublicensing income).  In addition, the agreement gave AsymmetRx the right to prosecute in its own name any infringement of the '256 and '227 patents, provided that AsymmetRx gave "careful consideration to the views of Harvard and to potential effects on the public interest in making its decision whether or not to sue" prior to filing suit.  Harvard also retained the right to join as a party in any such infringement action, and AsymmetRx was required to secure written consent from Harvard before settling or otherwise voluntarily disposing of any such infringement action.

In 2007, AsymmetRx sued Biocare for infringement of the '256 and '227 patents, alleging that Biocare's sale of p63 antibodies violated its exclusive rights.  The parties filed cross-motions for summary judgment, and the District Court granted Biocare's motion and denied AsymmetRx's motion.

In vacating the District Court's order granting summary judgment, the Federal Circuit determined that "Harvard retained substantial control over the patent rights it was exclusively licensing, such that its agreement with AsymmetRx did not convey all substantial rights under the patents and thus did not make the license tantamount to an assignment."  Because "AsymmetRx must therefore be considered a licensee, not an assignee," the panel determined that under Waterman v. Mackenzie, 138 U.S. 252 (1891), and subsequent cases, "AsymmetRx does not have a sufficient interest in the '256 and '227 patents to sue, on its own, as the 'patentee' entitled by 35 U.S.C. § 281 to judicial relief from infringement" (absent joinder of the patentee).

In reaching this determination, the Court compared the terms of the AsymmetRx license with those of licenses in three other CAFC cases, and determined that the terms of the AsymmetRx license were more similar to those in the license at issue in Abbott Labs. v. Diamedix Corp., 47 F.3d 1128, 1130 (Fed. Cir. 1995), than the licenses at issue in Vaupel Textilmaschinen KG v. Meccanica Euro Italia S.P.A., 944 F.2d 870, 874 (Fed. Cir. 1991), and Speedplay, Inc. v. Bebop, Inc., 211 F.3d 1245 (Fed. Cir. 2000).  Under the license in Abbott, the patentee retained a limited right to make, use, and sell products embodying the patented inventions, a right to bring suit if the licensee declined to do so, and the right to prevent the licensee from assigning its rights under the license to any party other than a successor in business.  In addition, the licensee could not "prejudice or impair the patent rights" in prosecuting or settling any infringement action.  In Vaupel, the license allowed the patentee to retain a veto right on sublicensing, the right to obtain patents on the invention in other countries, a reversionary right in the patent in the event of bankruptcy, and a right to receive infringement damages, the licensee was granted the right to sue in its entirety, subject only to the obligation to inform the patentee of the existence of the suit.  Finally, in Speedplay, the license did not grant the original patentees the right to participate in an infringement action brought by the licensee, or limit the licensee's management of that action.  In view of these three cases, the panel determined that:

This case is more similar to Abbott than to Vaupel or Speedplay in terms of what rights Harvard retained under the patents.  Although the AsymmetRx License effected a broad conveyance of rights to AsymmetRx, Harvard retained substantial interests under the '256 and '227 patents, including the right to sue for infringement, and AsymmetRx therefore does not have the right to sue for infringement as "patentee" under the patent statute.

That Harvard had licensed rights to anti-p63 antibodies to both Biocare and AsymmetRx (the latter in the form of an exclusive license) did not escape the panel's notice:

Harvard, by granting licenses to two parties involving the same subject matter, has potentially put itself in the conflicting position of having to aid two licensees opposed to each other.  Complicating matters is the fact that Harvard is continuing to accept royalty payments from Biocare resulting from sales in the commercial diagnostic market that AsymmetRx asserts are infringing its patent rights.  If anything, this added complication indicates that the purpose of Rule 19 [the federal joinder rule] to avoid multiple suits or incomplete relief arising from the same subject matter is best served by joinder of Harvard, which would permit the relationships between AsymmetRx, Biocare, and Harvard to all be resolved at the same time as well as solve the standing problem.

AsymmetRx, Inc. v. Biocare Medical, LLC (Fed. Cir. 2009)
Panel: Circuit Judges Lourie and Rader and District Judge Clark
Opinion by Circuit Judge Lourie

WIPO Releases Report on Worldwide IP Rights

    By Donald Zuhn --

Last week, the World Intellectual Property Organization (WIPO) released a report on intellectual property trends showing that the number of filed patent, trademark, and industrial design applications increased in 2007 ("World Intellectual Property Indicators 2009").  However, preliminary results for 2008 indicate that application filings dropped last year, a result not altogether surprising given the economic crisis that began in December 2007.  Concerning the preliminary findings showing an IP downturn in 2008, WIPO Director General Dr. Francis Gurry noted that "[h]istory has shown . . . that companies and countries which continue to invest in new products and innovation during times of economic recession will be those that will be best positioned to take advantage of the recovery, when it arrives."

With regard to filed patent applications, the 110-page report indicates that worldwide patent filings increased by 3.7% in 2007, the last year for which complete worldwide statistics were available.  However, the increase in 2007 patent filings was not as high as the 5.2% increase observed in 2006.  While preliminary data indicate that fewer patent applications were filed last year than in 2007, the report states that the depth of the slowdown remains unclear.  Interestingly, despite the drop in worldwide patent applications in 2008, the number of PCT applications filed last year actually increased by 2.3%.

The report also indicates that in 2007, 59.2% of all patent applications were filed in China, Japan, and the U.S., and 74.4% of all issued patents coming from the five largest offices (Japan, U.S., Korea, China, and the EPO).  In addition, the report shows that 43.3% of all patent applications were filed in 2007 by non-residents.  The report further reveals that the backlog of unprocessed worldwide patent applications reached 4.2 million in 2007, with the USPTO accounting for about 28% of the backlog, followed by Japan, the EPO, and Korea.  With regard to patent application filings by field of technology, the report indicates that between 2002 and 2006, organic chemistry filings were down 0.8%, biotechnology filings were down 3.8%, and pharmaceutical filings were up 3.1%.

The report also indicates that 764,700 patents were issued worldwide in 2007, an increase of 1.6% over 2006.  The 2007 increase in issued patents, however, was far below the 19.4% increase observed in 2006.  The report attributes the slowdown in issued patents to a "substantial decrease" in patents granted by the U.S. Patent and Trademark Office and the European Patent Office.  In addition, the report notes that the USPTO, which had led all other countries in issued patents since 1998, was overtaken by Japan in 2007.  China also overtook the EPO as the fourth largest office in terms of issued patents, with the Republic of Korea taking the third spot.  The report states that about 6.3 million patents were in force in 2007, with residents of Japan and the USA owning approximately 47% of this total.

The report also provides a listing of the Top 20 PCT applicants in the business sector and the university sector.  Of the twenty companies making the business sector list, the only company having any biotech or pharma ties was DuPont (at #20).  The Top 20 PCT filers for the university sector are indicated in the table below.

Patent Profile: Advaxis Granted New U.S. Patent in Protein Adjuvant Technology Portfolio

    By Sherri Oslick --

Last week, Advaxis, Inc., a biotechnology corporation focused on using a bioengineered bacterium, Listeria monocytogenes (Lm), to activate the immune system to treat cancer, infectious disease, or allergic syndromes, was issued U.S. Patent No. 7,588,930 ("Compositions and Methods for Enhancing the Immunogenicity of Antigens").  The '930 patent is directed to the use of Lm protein ActA and fragments thereof for use in the creation of antigen fusion proteins; the ActA protein was found to possess immuno-adjuvant properties.  The patent is assigned to The Trustees of the University of Pennsylvania, and licensed exclusively by Advaxis.

The claims are directed to Lm vaccine strains comprising an antigen fused to a truncated ActA protein, as well as methods of eliciting an enhanced immune response to an antigen using the claimed vaccine strains.  Representative claims include:

1.  A Listeria monocytogenes vaccine strain comprising an antigen fused to a truncated ActA protein, wherein said truncated ActA protein consists of amino acids 1-390 of said ActA protein; wherein said truncated ActA protein comprises a PEST-like sequence selected from the sequences set forth in SEQ ID No: 2-5; and wherein said antigen is selected from the group consisting of human papilloma virus (HPV) E6, HPV E7, Her-2/Neu, NY-ESO-1, human telomerase, WT-1, proteinase 3, TRP-2 and PSA antigen.

6.  A method of eliciting an enhanced immune response to an antigen, the method comprising administering to a subject an effective amount of a composition comprising a Listeria monocytogenes vaccine strain comprising said antigen fused to a truncated ActA protein, wherein said truncated ActA protein consists of amino acids 1-390 of said ActA protein; and wherein said truncated ActA protein comprises a PEST-like sequence selected from the sequences set forth in SEQ ID No: 2-5; and wherein said antigen is selected from the group consisting of human papilloma virus (HPV) E6, HPV E7, Her-2/Neu, NY-ESO-1, human telomerase, WT-1, proteinase 3, TRP-2, and PSA antigen.

This patent adds to Advaxis' patent portfolio directed toward creating specific and effective vaccines by using a variety of antigens and adjuvant proteins to target different types of cancers and infectious disease indications.

Roll Call Authors Unite against Current Follow Biologics Legislation

    By Donald Zuhn --

Earlier this month, James Love and James Glassman, writing in the Congressional newspaper Roll Call, expressed "alarm" regarding recent Congressional action concerning the establishment of a follow-in biologics (FOB) regulatory pathway ("Don't Kill Competition for High-Tech Drugs").  That action included the recent passage by the House Committee on Energy and Commerce of a health care reform bill containing a licensure pathway for biosimilar biological products that would prevent the FDA from approving a biosimilar application until 12 years after the date on which the reference product (i.e., the innovator biologic) was first licensed (see "House Committee Approves Health Care Reform Bill Calling for 12-Year Exclusivity Period"), and prior approval by the Senate Health, Education, Labor and Pensions (HELP) Committee of an amendment providing a 12-year data exclusivity period for biologic drug makers (see "Senators Champion 12-Year Data Exclusivity in Senate").

James Love (at right), the director of the public interest advocacy group Knowledge Ecology International, and James Glassman (below left) the former under secretary of State for public diplomacy and public affairs in the George W. Bush administration and editor of Roll Call from 1988-93, contend that passage of FOB provisions by the House Energy and Commerce and Senate HELP Committees would "make it difficult, if not impossible, for generic drugs to compete with biologics, even after patents have expired."  The authors add that these provisions, if reconciled and passed into law, have "the potential to harm millions of sick people, in the United States and beyond."

Mr. Love's and Mr. Glassman's assertions are based on a comparison of the predicted impact of the House and Senate provisions with that of the Hatch-Waxman Act, which they note provided "streamlined procedures [that] lowered the cost of entry by generic suppliers and created a highly competitive environment that has saved consumers billions of dollars."  According to the authors, the FOB regulatory pathway currently being proposed by Congress is "deeply flawed and will reduce, or even eliminate, potentially significant savings to consumers."

Mr. Love and Mr. Glassman make it clear that the "flaw" in the process is the exclusivity period, which unlike the 5-year period for small molecule generics under Hatch-Waxman, at present stands at 12-years for biogenerics.  They state that "[t]he original proposal for biogenerics would have retained most of the features of the 1984 Hatch-Waxman Act, including the five-year exclusion [i.e., exclusivity period]."  However, their assertion is not entirely accurate, since one of the two House FOB bills introduced last spring (H.R. 1548) called for up to 14.5 years of exclusivity (see "Second Follow-on Biologics Bill Is Introduced in House").  It also disregards the White House's call, in June, for an exclusivity period longer than 5 years (see "White House Recommends 7-Year Data Exclusivity Period for Follow-on Biologics").  Instead, the authors argue that "after an intense lobbying campaign by the manufacturers of biologics, new amendments to the Senate and House versions of the bill made it much more difficult for makers of generics to enter the market."  Again, this statement is somewhat disingenuous in that it ignores the fact that Rep. Anna Eshoo (D-CA), who helped introduce the 12-year amendment in the House Energy and Commerce Committee, also introduced H.R. 1548 last spring as well as a similar bill in the last Congress (see "New Follow-on Biologics Bill Introduced in the House").  Thus, Rep. Eshoo did not succumb to "an intense lobbying campaign" in introducing the amendment, but rather has been pushing for a double-digit exclusivity period since March of 2008.  (In fact, in proposing a 12-year period, Rep. Eshoo actually backed off the longer period she had been seeking.)

Noting that "Members of Congress from both parties have claimed that long monopolies are needed to stimulate investments in research and development," the authors declare their strong disagreement with this position.  Although they acknowledge that developmental costs for new biologics are "undoubtedly expensive," they contend that "this is just as true for products that the FDA classifies as 'small-molecule,' or conventional, drugs as it is for biologics."  Mr. Love and Mr. Glassman also argue that "innovation has prospered under the Hatch-Waxman regime."  Biologic manufacturers, however, would likely disagree with these assertions, and Amgen Inc. Vice President and Law & Intellectual Property Officer Stuart Watt did just that last March in a presentation at the Biotechnology Industry Organization (BIO) Intellectual Property Counsels' Committee (IPCC) conference (see "Amgen VP Makes Case for Longer Exclusivity Period in Follow-on Biologics Legislation").

Mr. Love and Mr. Glassman conclude their article by noting that while Article I, Section 8, Clause 8 of the Constitution confers upon Congress the power "[t]o promote the Progress of Science and useful Arts, by securing for limited Times to Authors and Inventors the exclusive Right to their respective Writings and Discoveries," the Founders "understood the need for balance in creating monopolies that were temporary" -- i.e., which existed for limited times.  The authors state that "[e]ndless monopolies, particularly those created by regulatory measures, must be avoided," concluding that "a 12-year exclusion simply does not meet the test of logic."

Conference & CLE Calendar

September 21-22, 2009 - 2009 World Stem Cell Summit*** - Baltimore, MD

September 21-22, 2009 - Patent Litigation 2009 (Practising Law Institute) - San Francisco, CA

September 23-25, 2009 - 10th Annual Generic Drugs Summit on the Business of Biosimilars (Institute for International Research) - Boston, MA

September 30-October 1, 2009 - Biotech Patents*** (American Conference Institute) - Boston, MA

October 5-6, 2009 - Patent Litigation 2009 (Practising Law Institute) - McLean, VA

October 7-8, 2009 - Maximizing Pharmaceutical Patent Lifecycles*** (American Conference Institute) - New York, NY

October 14, 2009 - Developments in Pharmaceutical and Biotech Patent Law (Practising Law Institute) - San Francisco, CA

October 15-16, 2009 - Patent Litigation 2009 (Practising Law Institute) - Chicago, IL

October 20-21, 2009 - 17th Forum on Biotech Patenting (C5) - London, United Kingdom

October 22-23, 2009 - Pharmaceutical Congress on Paragraph IV Disputes*** (Center for Business Intelligence) - Philadelphia, PA

October 26-28, 2009 - Intellectual Property Counsels' Committee (IPCC) Fall Conference & Meeting (Biotechnology Industry Organization) - Washington, DC

October 28-29, 2009 - Patent Opinion Writing Boot Camp*** (American Conference Institute) - Philadelphia, PA

November 9-10, 2009 - Patent Litigation 2009 (Practising Law Institute) - Atlanta, GA

November 9-11, 2009 - Developing IP Strategies for Crystalline Forms*** (International Quality & Productivity Center) - London, England

November 10, 2009 - The Patent Cooperation Treaty (PCT): Important Tool for Small and Medium-Sized Enterprises (SMEs) and Independent Inventors (World Intellectual Property Organization) - Baltimore, MD

November 12-13, 2009 - Paragraph IV on Trial*** (American Conference Institute) - New York, NY

November 13, 2009 - The Patent Cooperation Treaty (PCT): Important Tool for Small and Medium-Sized Enterprises (SMEs) and Independent Inventors (World Intellectual Property Organization) - Las Vegas, NV

November 16-17, 2009 - Patent Litigation 2009 (Practising Law Institute) - New York, NY

November 17-18, 2009 - Structuring, Negotiating, and Managing Pharma/Biotech Collaborative Agreements (American Conference Institute) - New York, NY

December 7-8, 2009 - Foreign Patent Law & Regulation*** (American Conference Institute) - New York, NY

***Patent Docs is a media partner of this conference or CLE

ACI Foreign Patent Law & Regulation Conference

American Conference Institute (ACI) will be holding a conference on Foreign Patent Law & Regulation for the U.S. Life Sciences Patent Practitioner from December 7-8, 2009 in New York, NY.  The conference will allow attendees to:

• Develop a strategic plan for deciding when and where to file life sciences patents abroad;
• Prosecute and file life sciences and pharmaceutical patents in emerging Asian markets;
• Navigate unique issues that arise in the context of seeking supplementary protection certificates (SPCs) and method of use/treatment claims in life sciences patents;
• Address cultural idiosyncrasies and technical requirements in various jurisdictions when developing international patent litigation strategy;
• Select and manage a multi-jurisdictional patent litigation team;
• Seek damages and pursue available remedies abroad -- knowing what you can (and cannot get) and where you can get it; and
• Assess the impact of the EC Sector inquiry on global pharmaceutical patent life cycles.

In particular, ACI's faculty will offer presentations on the following topics:

• Why now?  Understanding the importance of developing a global strategy for a life sciences patent portfolio;
• Evaluating advantages and limitations of foreign filing conventions and treaties;
• Foreign patent offices:  Exploring filing and prosecution protocols;
• Filing and prosecuting life sciences & pharmaceutical patents in emerging Asian markets;
• Guidelines for evaluating standards of patentability and selecting the best jurisdictions in which to file an international life sciences patent;
• Strategies for successfully obtaining method of use/treatment claims;
• Navigating the "ins" and "outs" of opposition practice in Europe and Asia;
• Supplementary protection certificates (SPCs):  Strategies for successfully extending the patent term on a life sciences invention;
• Balancing competing antitrust and IP interests:  Assessing the impact of the EC Pharmaceutical Sector Inquiry on the exercise and defense of patent rights;
• Considerations for U.S. life sciences companies when filing patent suits abroad and selecting foreign litigation counsel;
• Successfully seeking injunctive relief for a life sciences patent:  Strategies for the EU and Asia;
• Organizing and managing a foreign patent litigation team and strategy;
• Understanding the mechanics of conducting and seeking discovery in foreign jurisdictions;
• Obtaining, calculating, and evaluating the scope of available damages abroad; and
• Caselaw update:  Emerging trends in foreign life sciences patent litigation.

An additional post-conference workshop entitled "Mastering the Interplay between Foreign Patent Law and Regulatory Requirements for Life Sciences Companies in the EU and Asia" will be offered from 9:00 am to noon on December 9, 2009.  During the workshop, ACI faculty will provide a comprehensive overview of the basics of patent protection and regulatory approval required for the commercial viability of life sciences products in the EU and emerging Asian jurisdictions.

According to an ACI release, the Foreign Patent Law & Regulation conference has been designed to provide in-house patent and IP counsel within the pharmaceutical, biopharmaceutical, biotechnology, and medical device industries with a working knowledge of the current status of patent law in key foreign jurisdictions, including the EU and emerging Asian markets.  A leading faculty comprised of experienced in-house counsel representing such multi-national companies as Allergan, Boehringer Ingelheim, GlaxoSmithKline, Medtronic, Novartis, Novo Nordisk, Purdue Pharma, sanofi-aventis, Sanofi Pasteur, and Schering-Plough, as well as patent prosecution attorneys and litigation counsel from Australia, Belgium, China, India, Germany, Japan, Korea, Netherlands, Switzerland, and the United Kingdom will provide attendees with an in-depth overview of the unique issues that arise in the context of both prosecution and litigation outside the U.S.

The agenda for the Foreign Patent Law & Regulation conference can be found here.  A complete brochure for this conference, including an agenda, list of speakers, and registration form can be downloaded here.

The registration fee for the conference is $2,195 (conference alone) or $2,795 (conference and workshop).  Those registering on or before October 2, 2009 will receive a $300 discount off the registration fee and those registering on or before November 6, 2009 will receive a $200 discount off the registration fee.  ACI will also provide a $200 discount off the standard price to all Patent Docs readers who reference the discount code "Patent Docs" when registering.  Those interested in registering for the conference can do so here, by calling 1-888-224-2480, or by faxing a registration form to 1-877-927-1563.

Patent Docs is a media partner of ACI's Foreign Patent Law & Regulation conference.

Tech Companies Send Letter on Patent Reform to Secretary Locke

    By Donald Zuhn --

On Monday, a group of 56 companies sent a letter to Secretary of Commerce Gary Locke (below) urging the Secretary "to push for improvements" to the post-grant and inter partes examination provisions of patent reform legislation currently before Congress.  The Seattle PI's Microsoft blog published a copy of the letter on Wednesday in an article entitled "Tech cos. protest patent reform in letter to Locke."

In the letter, the group acknowledges that "some versions of the legislation have been improved this Congress," but asserts that "additional improvements are in order to ensure that the end product avoids serious unintended consequences."  According to the signatories, the "two most contentious issues in the patent reform debate relate to patent damages and the expansion of administrative challenges to patent validity."  With respect to the first issue, the letter commends the Senate for resolving the patent damages issue by introducing a "gatekeeper" provision, and urges Secretary Locke to support that approach (see "Senate Judiciary Committee Holds Hearing on Patent Reform" and "Senate 'Patent Reform' Bill (S. 515) Voted out of Judiciary Committee").  The group states that "[a]ny effort to go back to previous [damages] proposals will, in our view, endanger the entire patent reform effort."

With respect to the second issue, however, the group predicts that post-grant review and inter partes examination provisions in the current legislation "will have serious negative consequences which must be considered."  The letter notes that these provisions will put additional strain on an already burdened Patent Office, and contends that "[a]dding new obligations to the agency at this time seems extraordinarily unwise."  If the current provisions are passed into law, the group foresees "longer patent pendency and lower patent quality."  In addition, the signatories contend that such provisions would be "vulnerable to a high level of abuse" by "allow[ing] infringers to subject valid patents to lengthy and repeat challenges."  In support of its contentions, the group cites a November 2007 article co-authored by Yongshun Cheng (former Senior Judge and Deputy Presiding Judge of the Intellectual Property Division of Beijing High People's Court) and Li Lin, which concluded that the patent reform bill passed by the House in September 2007 "is friendlier to the infringers than to the patentees in general as it will make [U.S.] patent[s] less reliable, easier to be challenged and cheaper to be infringed" (see "Chinese IP Judge Discusses Implications of U.S. Patent Reform Bill and Two Congressmen Heed Warning").

The group contends that abuse of the post-grant review and inter partes examination provisions "will be harmful to American innovators who rely on strong patents," and therefore, urges Secretary Locke "to push for improvements to these provisions which will limit the ability of infringers to undermine the very system the legislation attempts to strengthen."

The 56 signatories to the letter include:  Abbott Medical Optics Inc.; Acclarent, Inc.; Acorn Cardiovascular, Inc.; Allergan Inc.; Applied Medical; ARCH Venture Partners; Ardian, Inc.; Asthmatx, Inc.; ATS Medical; Aware, Inc.; Biomerix Corporation; Calibra Medical; Carticept Medical, Inc.; Conceptus, Inc.; Corning Inc.; Cryptography Research, Inc.; Cummins-Allison; Cyberonics; Digimarc Corp.; Dolby Laboratories; Dynatronics Corp.; Elemé Medical Inc.; Evalve, Inc.; ExploraMed Development, LLC; Fallbrook Technologies Inc.; The Foundry, LLC; ForSight; ForSight VISION3; ForSight VISION4; GeneEx, Inc.; Ikaria Holdings, Inc.; InterDigital, Inc.; Intermolecular; Medigroup Inc.; Miramar Labs, Inc.; Mohr Davidow Ventures; Monsanto; Moximed, Inc.; NeoTract, Inc.; NeoVista, Inc.; Neuro Resource Group, Inc.; NeuroPace, Inc.; Nims, Inc.; Novasys Medical; Optimum Performance Solutions LLC; OsteoMed; Paracor Medical, Inc.; PolyRemedy, Inc.; Qualcomm Inc.; Streamline; Tessera; TherOx; Transonic Systems Inc.; Urovalve Inc.; U.S. Venture Partners; Venture Investors; The Vertical Group; Vibrynt, Inc.; and Viryd Technologies Inc.

Prometheus Laboratories, Inc. v. Mayo Collaborative Services (Fed. Cir. 2009)

Medical Diagnostics Claims Are Patentable Subject Matter

    By Kevin E. Noonan --

Over the past few years, Federal Circuit decisions in In re Bilski and Classen Immunotherapeutics, Inc. v. Biogen Idec, combined with Justice Breyer's dissent in Laboratory Corp. v. Metabolite Labs., Inc. ("LabCorp"), have created more than a frisson of anxiety in the biotechnology and medical diagnostics community, due the apprehension that medical diagnostics claims might generally be deemed not to be patent-eligible subject matter under 35 U.S.C. § 101.  These fears may be alleviated to some degree by the decision today in Prometheus Laboratories, Inc. v. Mayo Collaborative Services, where the Court held that a diagnostics claim satisfies the machine-or-transformation test enunciated in Bilski.

The case relates to U.S. Patent Nos. 6,335,623 and 6,680,302, which were exclusively licensed by Prometheus.  Defendants Mayo Collaborative Services and Mayo Clinic Rochester used the technology covered by these patents, until Mayo unilaterally announced that it intended to use its own test internally and to sell the test to other hospitals.  Prometheus brought suit and the District Court granted summary judgment in Prometheus' favor that Mayo's test literally infringed claim 7 of the '623 patent.  All of the patent claims relate to methods for identifying metabolites of thiopurine, a drug used to treat various gastrointestinal disorders such as Crohn's disease and ulcerative colitis.  Claim 1 of the '623 patent was cited in the Federal Circuit opinion as being representative:

A method of optimizing therapeutic efficacy for treatment of an immune- mediated gastrointestinal disorder, comprising:
    (a) administering a drug providing 6-thioguanine to a subject having said immune-mediated gastrointestinal disorder; and
    (b) determining the level of 6-thioguanine in said subject having said immune-mediated gastrointestinal disorder,
    wherein the level of 6-thioguanine less than about 230 pmol per 8x108 red blood cells indicates a need to increase the amount of said drug subsequently administered to said subject and
    wherein the level of 6-thioguanine greater than about 400 pmol per 8x108 red blood cells indicates a need to decrease the amount of said drug subsequently administered to said subject.

The District Court granted summary judgment in favor of the defendants that the claims of the '623 and '302 patents were invalid under 35 U.S.C. § 101 for failure to recite patent-eligible subject matter, stating that merely because the inventors:

have framed the claims as "treatment methods" does not make the claims patentable.  Indeed, "one can reduce any process to a series of steps.  The question is what those steps embody."  Lab. Corp. of Am. Holdings v. Metabolite, Inc., 548 U.S. 124 (2006) (Breyer, J., dissenting from dismissal of certiorari) (emphasis in original); see also In re Grams, 888 F.2d 835, 839 (Fed. Cir. 1989) (explaining that the critical question is: "What did applicants invent?") (quoting In re Abele, 684 F.2d 902, 907 (C.C.P.A.1982)) . . .  [T]he "administering" and "determining" steps are merely necessary data-gathering steps for any use of the correlations.  However, an "unpatentable principle" will not transform into a "patentable process" simply by adding conventional method steps.  . . .  [The [wherein or] "warning" step [in a mental step that] does not require that dosage be adjusted, or any other action.  . . .  [I]t is the metabolite levels themselves that "warn" the doctor that an adjustment in dosage may be required.

The District Court held that "the patents claimed the correlations between certain thiopurine drug metabolite levels and therapeutic efficacy and toxicity."  These correlations were "natural phenomena" according to the District Court, and thus unpatentable "because the correlations resulted from a natural body process."  The inventors of the '623 and '302 patents did not invent the correlation, according to the lower court's invalidity opinion, because the metabolites detected according to the patent claims "are products of the natural metabolizing of thiopurine drug, and the inventors merely observed the relationship between these naturally-produced metabolites and therapeutic efficacy and toxicity."  Moreover, having determined that the claims encompass the correlations themselves, the District Court held that the claims "wholly preempt" the correlations.  The recited process steps, of administering a thiopurine drug and determining the levels of thiopurine metabolites in a patient's blood, were "merely necessary data-gathering steps," and the final step constituting the "wherein" clause of claim 1 of the '623 patent (for example) is merely a "mental step," according to the District Court, since it did not recite any action mandating that a physician adjust the administered dosage of the thiopurine drug.

The Federal Circuit reversed, in an opinion by Judge Lourie joined by Chief Judge Michel and the Honorable Ron Clark, District Judge of the U.S. District Court for the Eastern District of Texas, sitting by designation.  The opinion cited as context the Supreme Court's expansive definition of patentable subject matter in Diamond v. Chakrabarty and its limits, as in Diamond v. Diehr and Gottschalk v. Benson, as well as how methods were defined broadly by Congress under 35 U.S.C. § 100(b), but the analytical framework of the decision was the machine-or-transformation test in In re Bilski.  Citing Bilski, the Court framed the issue before it as follows:

The key issue for patentability, then, at least on the present facts, is whether a claim is drawn to a fundamental principle or an application of a fundamental principle.

The CAFC turned to Bilski to address this "key issue," with one additional caveat in guiding its application.  The Supreme Court, said Judge Lourie, "has also made clear that the patent eligibility of a claim as a whole should not be based on whether selected limitations constitute patent-eligible subject matter . . . [I]t is "inappropriate to dissect the claims into old and new elements and then to ignore the presence of the old elements in the analysis," citing Diehr, and that "it is improper to consider whether a claimed element or step in a process is novel or nonobvious, since such considerations are separate requirements set forth in 35 U.S.C. §§ 102 and 103, respectively," citing Bilski and Diehr.

Turning to the claims at issue, the Federal Circuit held that the administering and determining steps, dismissed by the District Court as constituting mere "necessary data-gathering steps," were instead transformative and thus satisfy the transformation prong of the Bilski machine-or-transformation (for convenience, MOT) test.  The CAFC opined that "[t]he transformation is of the human body following administration of a drug and the various chemical and physical changes of the drug's metabolites that enable their concentrations to be determined."  The Court found that these steps were essentially "method of treatment" steps, "which are always transformative when a defined group of drugs is administered to a body to alleviate the effects of an undesired condition" (emphasis added).  A human body to which drugs such as thiopurines are administered "necessarily undergoes a transformation," since "the drugs do not pass through the body untouched without affecting it," which the Court characterized as "the entire purpose of administering the drugs."  The Court rejected Mayo's contention that the transformations are the result of "natural processes" because "quite literally every transformation of physical matter can be described as occurring according to natural processes and natural law."  But the transformation encompassed by the administering step of the asserted claims are not "natural processes" according to the Court:  "[i]t is virtually self-evident that a process for a chemical or physical transformation of physical objects or substances is patent-eligible subject matter (emphasis in the original text).  Ironically noted in a footnote, the Court dismissed Justice Breyer's Metabolite dissent, upon which the District Court "relied heavily on," summarily:  "[t]hat dissent is not controlling law."

The considerations that guided the panel in deciding that the administration steps were transformative also apply to the metabolite-determining steps, according to the Court, since metabolite levels "cannot be determined by mere inspection."  The Court cited in this regard Prometheus' expert, to the effect that "at the end of the process [of metabolite-determining], the human blood sample is no longer human blood; human tissue is no longer human tissue," i.e., these samples have been transformed.

The Court's opinion also rejected any characterization of the administering and metabolite-determining steps as being "insignificant extra-solution activity."  Failure to recognize this was "the crucial error" made by the District Court, according to Judge Lourie.  In this analysis, the Federal Circuit applied the teachings of In re Grams, a case cited by the District Court in coming to its "extra-solution activity" conclusion.  The Federal Circuit distinguished the claims at issue here, which recite patent-eligible subject matter, from the claims in Grams, which did not, because in Grams "the essence of the claimed process was [a] mathematical algorithm, rather than any transformation of the tested individuals," being "merely an algorithm combined with a data gathering step."

The opinion also asserted that, even if the "warning" step encompassed in the "wherein" clause of claim 1 of the '623 patent was merely a mental step, it "does not detract from patentability" (or, more properly, patent-eligibility).  Looking at the claim "as a whole":

The data that the administering and determining steps provide for use in the mental steps is obtained by steps well within the realm of patentable subject matter.  The addition of the mental steps to the claimed methods thus does not remove the prior two steps from that realm.

And citing Bilski:

[I]t is inappropriate to determine the patent eligibility of a claim as a whole based on whether selected limitations constitute patent-eligible subject matter.  After all, even though a fundamental principle itself is not patent-eligible, processes incorporating a fundamental principle may be patent-eligible.  Thus, it is irrelevant that any individual step or limitation of such processes by itself would be unpatentable under § 101.

Finally, the Federal Circuit opined that the District Court erred in deciding that Prometheus' asserted claims "wholly preempted" the use of correlations between metabolites of thiopurine drugs and their toxicity and efficacy.  Rather, according to the Court, the claims utilize, not preempt, the correlations of natural processes "in a series of specific steps" that are patent-eligible subject matter according to the statute, citing Diehr and its analogous use of the Arrhenius equation for curing rubber (a transformative step).  "Regardless," according to the Court, of this issue, satisfaction of the MOT test renders the claims patent-eligible and thus "they do not preempt a fundamental principle."

The decision in the Prometheus case comes as at least a temporary balm to the diagnostics industry, since similar claims in Classen had been summarily (and tersely) rejected by the Federal Circuit as failing the Bilski MOT test (see Patent Docs post).  The Court's recognition in this case of the transformative nature of method claim steps reciting administering, or assaying, or determining, or immunizing thus reconciles the application of the Court's Bilski precedent with physical reality (not to mention common sense).  It also provides inventors and their counsel with tools to adapt their diagnostic method claims to satisfy the test, and precedent to defend patent-eligibility when challenged at the Patent Office or in litigation.  Diagnostic methods companies can now breathe a cautious sigh of relief, at least until the Supreme Court decides Bilski later this year.

Prometheus Laboratories, Inc. v. Mayo Collaborative Services (Fed. Cir. 2009)
Panel: Chief Judge Michel, Circuit Judge Lourie, and District Judge Clark
Opinion by Circuit Judge Lourie

Interactive Graphic Illustrates How U.S. Patent System Has Driven American Economy

    By Donald Zuhn --

Last month, the Milwaukee Journal Sentinel published two articles documenting the current state of the U.S. patent system (see "The Milwaukee Journal Sentinel Gets It Right about Patents").  The authors of those pieces, John Schmid and Ben Poston, have now compiled an interactive graphic that shows how the U.S. patent system has shaped American history and innovation.  The graphic contains a number of elements, including a timeline of key patents and significant events in American history, a comparison of domestic and foreign patents issued between 1790 and 2009, and charts showing the top countries and states in which U.S. patents originated, the number of pending applications between 1981 and 2009 and average application pendency between 1983 and 2008, fee diversion between 1992 and 2004, and rapid growth of the Chinese patent system between 1999 and 2008.

Among the patents making the Journal Sentinel's timeline are the issuance in 1928 of U.S. Patent No. 1,680,818 to Harry Steenbock, the issuance in 1948 of U.S. Patent No. 2,442,141 to Andrew Moyer, and the issuance in 1998 of U.S. Patent No. 5,843,780 to James Thomson.  The '818 patent, which is directed to an antirachitic product and process (i.e., a process for enhancing Vitamin D in "organic substances of dietary value").  Dr. Steenbock secured a Nobel nomination in 1929 for the work leading to the '818 patent, and the success of the patent helped launch the Wisconsin Alumni Research Foundation (WARF).  The '141 patent is directed to a method a producing penicillin, and the '780 patent is the first embryonic stem cells patent.  The timeline also includes the Diamond v. Chakrabarty decision, which the authors state spurred an "unprecedented growth in biotechnology," among its significant events.

Amgen Inc. v. F. Hoffman-La Roche Ltd. (Fed. Cir. 2009)

Something for Everyone, but the Injunction Stands

    By Kevin E. Noonan --

Amgen has several times successfully defended its erythropoietin (EPO) franchise, the company's first commercial success and in many ways the crown jewel of its (or anyone's) biologics drug pipeline.  That string of successes continued today with a decision by the Federal Circuit against its latest challenger, Hoffman-La Roche.  But the decision also put several of the patents protecting Amgen's EPO at risk, making this a mixed victory at best for the biotechnology company.

The case involved the most recent challenge, Roche's Mircera® product, a pegylated derivative of human EPO.  Amgen sued Roche in a declaratory judgment action in Massachusetts asserting six patents:  U.S. Patent Nos. 5,547,933 (the '933 patent), 5,441,868 (the '868 patent), and 5,618,698 (the '698 patent), U.S. Patent Nos. 5,955,422 (the '422 patent, claim 1) and 5,756,349 (the '349 patent, claim 7) and U.S. Patent No. 5,621,080 (the '080 patent).  On October 23, 2007, a jury found that Mircera® infringed the '933 patent, the '868 patent and the '698 patent, and that these patents as well as the '422 patent and the '349 patent were not invalid.  (The jury reached neither infringement nor validity of the '080 patent).  Specifically, the jury found that Roche's Mircera® infringed claims 3, 7, and 8 of the '933 patent (claim 12 was found not to be literally infringed but infringed under the Doctrine of Equivalents); claims 1 and 2 of the '868 patent; and claims 6 through 9 of the '698 patent.  On October 1, 2008, Massachusetts District Court Judge William Young ruled (in Amgen's favor for each) on several post-trial motions, including:  1) affirming the jury's infringement decision by denying Roche's motion for judgment as a matter of law (JMOL); 2) reaffirming its pretrial decision to grant summary judgment regarding infringement of claim 1 of the '422 patent; 3) "explaining" its reasoning for ruling, also pretrial, that the claims of Amgen's patents-in-suit are not invalid for obviousness-type double patenting (despite the intervening Federal Circuit decision in Pfizer, Inc. v. Teva Pharmaceuticals USA, Inc.); 4) denying Roche's motion for JMOL that claim 1 of the '422 patent and claims 3, 7, and 9 of the '933 patent are not invalid for indefiniteness for reciting the term "human erythropoietin"; and 5) granting Amgen a permanent injunction barring "Roche, its agents, servants, employees, counsel, and all persons and entities acting in concert therewith" from infringing the claims of the patents-in-suit for the remaining life of those patents.

The Federal Circuit's decision, written by Judge Schall and joined by Judges Mayer and Clevenger, affirmed most of the determinations by the District Court and the jury.  These will be discussed more extensively in future posts, but can be summarized simply here:  the panel vacated Judge Young's decision on whether the '933 (claims 3, 7, and 8), '349 (claim 7) and '422 (claim 1) patents are not invalid under obviousness-type double patenting and remanded this issue to the trial court; vacated the judgment that claim 7 of the '349 patent was not infringed and remanded for a new trial on that issue; affirmed the judgments that the asserted claims of the '868 patent (claims 1 and 2) and the '698 patent (claims 6-9) are not invalid and were infringed, and that claims 3, 7, and 8 of the '933 patent and claim 1 of the '422 patent were infringed; and finally that claims 9, 11, 12, and 14 of the '933 patent are not infringed by Mircera®.

Because of the number claims asserted and the status of these various claims under the CAFC's opinion, a scorecard seems in order:

The following claims of the '933 patent are infringed but may be invalidated by the trial court for obviousness-type double patenting:

3.  A non-naturally occurring glycoprotein product of the expression in a mammalian host cell of an exogenous DNA sequence comprising a DNA sequence encoding human erythropoietin said product possessing the in vivo biological property of causing bone marrow cells to increase production of reticulocytes and red blood cells.

7.  The glycoprotein product according to claim 3 . . . wherein the host cell is a non-human mammalian cell.

8.  The glycoprotein product according to claim 7 wherein the non-human mammalian cell is a CHO cell.

The following claim is infringed by Mircera® under the doctrine of equivalents, but its status with regard to the obviousness-type double patenting question is uncertain (it does not fall within the CAFC's remand):

12.  A pharmaceutical composition comprising an effective amount of a glycoprotein product effective for erythropoietin therapy according to claim 7 and a pharmaceutically acceptable diluent, adjuvant or carrier.  [Infringed under the doctrine of equivalents.]

The following claims of the '868 patent are both not invalid and are infringed:

1.  A process for the production of a glycosylated erythropoietin polypeptide having the in vivo biological property of causing bone marrow cells to increase production of reticulocytes and red blood cells comprising the steps of:
    (a)  growing, under suitable nutrient conditions, mammalian host cells transformed or transfected with an isolated DNA sequence encoding human erythropoietin; and
    (b)  isolating said glycosylated erythropoietin polypeptide therefrom.

2.  The process according to claim 1 wherein said host cells are CHO cells.

The following claims of the '698 patent are not invalid and are infringed:

6.  A process for the production of a glycosylated erythropoietin polypeptide having the in vivo biological property of causing bone marrow cells to increase production of reticulocytes and red blood cells comprising the steps of:
    a) growing, under suitable nutrient conditions, vertebrate cells comprising amplified DNA encoding the mature erythropoietin amino acid sequence of FIG. 6; and
    b) isolating said glycosylated erythropoietin polypeptide expressed by said cells.

7.  The process of claim 6 wherein said vertebrate cells further comprise amplified marker gene DNA.

8.  The process of claim 7 wherein said amplified marker gene DNA is Dihydrofolate reductase (DHFR) gene DNA.

9.  The process according to claims 2, 4 and 6 wherein said cells are mammalian cells.

Claim 1 of the '422 patent is infringed but may be invalidated for obviousness-type double patenting:

1.  A pharmaceutical composition comprising a therapeutically effective amount of human erythropoietin and a pharmaceutically acceptable diluent, adjuvant or carrier, wherein said erythropoietin is purified from mammalian cells grown in culture.

Finally, infringement of claim 7 of the '349 patent will be decided in a new trial, but may be invalid under obviousness-type double patenting:

7.  A process for producing erythropoietin comprising the step of culturing, under suitable nutrient conditions, vertebrate cells according to claim 1, 2, 3, 4, 5 or 6.

Wherein claims 1 through 6 of the '349 patent related to vertebrate cells encoding recombinant EPO:

1.  Vertebrate cells which can be propagated in vitro and which are capable upon growth in culture of producing erythropoietin in the medium of their growth in excess of 100 U of erythropoietin per 10⁶ cells in 48 hours as determined by radioimmunoassay, said cells comprising non-human DNA sequences which control transcription of DNA encoding human erythropoietin.

The significance of the Federal Circuit's decision, and the consequences of an adverse decision on remand for the '933, '349 and '422 patents are illustrated by the respective expiration dates of the five patents at issue in the litigation:

*term shortened by terminal disclaimer

Thus, invalidation of the '933, '349 and '422 patents would reduce Amgen's patent protection on its various EPO products (including Aranesp® and Epogen®) from May 2015 to August 2012 (more than 3 years), which would have a significant (negative) effect on the corporate bottom line.  Accordingly, Amgen can be expected to continue this litigation.

The CAFC's opinion did not disturb the permanent injunction imposed by Judge Young, preventing Roche from marketing Mircera® in the U.S. despite obtaining FDA approval in November, 2007, giving Roche more than sufficient incentive to continue as well.

The substance of the Federal Circuit's opinion, including its reasoning on the standards for obviousness type double patenting, will be the subject of later posts.     

Amgen Inc. v. F. Hoffman-La Roche Ltd. (Fed. Cir. 2009)
Panel: Circuit Judges Mayer, Clevenger, and Schall
Opinion by Circuit Judge Schall